Transcript: Human NM_001927.4

Homo sapiens desmin (DES), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DES (1674)
Length:
2243
CDS:
87..1499

Additional Resources:

NCBI RefSeq record:
NM_001927.4
NBCI Gene record:
DES (1674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001927.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083147 CGGGAATTGGAGGACCGATTT pLKO.1 1134 CDS 100% 10.800 15.120 N DES n/a
2 TRCN0000083143 GCGGCTAAGAACATTTCTGAA pLKO.1 939 CDS 100% 4.950 6.930 N DES n/a
3 TRCN0000083144 CCATACCAAGAAGACGGTGAT pLKO.1 1406 CDS 100% 4.050 2.835 N DES n/a
4 TRCN0000083145 GCGTTCCTTAAGAAAGTGCAT pLKO.1 795 CDS 100% 2.640 1.848 N DES n/a
5 TRCN0000090796 CCAGTCCTACACCTGCGAGAT pLKO.1 1070 CDS 100% 1.350 0.945 N Des n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001927.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06093 pDONR223 100% 99.5% 100% None (many diffs) n/a
2 ccsbBroad304_06093 pLX_304 0% 99.5% 100% V5 (many diffs) n/a
3 TRCN0000470327 TGCGATAGTATCGTCGGGATTCTG pLX_317 24.6% 99.5% 100% V5 (many diffs) n/a
Download CSV