Transcript: Human NM_001945.3

Homo sapiens heparin binding EGF like growth factor (HBEGF), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
HBEGF (1839)
Length:
2358
CDS:
276..902

Additional Resources:

NCBI RefSeq record:
NM_001945.3
NBCI Gene record:
HBEGF (1839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372391 GGATTAGAATGCCGGTTAAAT pLKO_005 1208 3UTR 100% 15.000 21.000 N HBEGF n/a
2 TRCN0000062204 CCCATGTCTTCGGAAATACAA pLKO.1 593 CDS 100% 5.625 4.500 N HBEGF n/a
3 TRCN0000378783 AGGATTGGGCCTCCCATAATT pLKO_005 1030 3UTR 100% 15.000 10.500 N HBEGF n/a
4 TRCN0000372390 AGCACTGGCCACACCAAACAA pLKO_005 518 CDS 100% 5.625 3.938 N HBEGF n/a
5 TRCN0000062207 AGTGAAGTTGGGCATGACTAA pLKO.1 872 CDS 100% 4.950 3.465 N HBEGF n/a
6 TRCN0000062203 GAGGAGGTTATGATGTGGAAA pLKO.1 841 CDS 100% 4.950 3.465 N HBEGF n/a
7 TRCN0000062206 GAGAGTCACTTTATCCTCCAA pLKO.1 491 CDS 100% 2.640 1.848 N HBEGF n/a
8 TRCN0000062205 CTTCTCATGTTTAGGTACCAT pLKO.1 816 CDS 100% 0.000 0.000 N HBEGF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00466 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00466 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473982 CTCACAATAAGTCCACACCGGGGA pLX_317 59.3% 100% 100% V5 n/a
Download CSV