Transcript: Human NM_002079.3

Homo sapiens glutamic-oxaloacetic transaminase 1 (GOT1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GOT1 (2805)
Length:
1978
CDS:
60..1301

Additional Resources:

NCBI RefSeq record:
NM_002079.3
NBCI Gene record:
GOT1 (2805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294128 GAACCACATCACTGATCAAAT pLKO_005 1112 CDS 100% 13.200 18.480 N GOT1 n/a
2 TRCN0000034788 GTGCGGATTACTTGGTCCAAT pLKO.1 933 CDS 100% 4.950 3.960 N GOT1 n/a
3 TRCN0000306940 ACATCCCTTGAGACGAATTTG pLKO_005 1463 3UTR 100% 13.200 9.240 N GOT1 n/a
4 TRCN0000034785 GCTAATGACAATAGCCTAAAT pLKO.1 243 CDS 100% 13.200 9.240 N GOT1 n/a
5 TRCN0000286797 GCTAATGACAATAGCCTAAAT pLKO_005 243 CDS 100% 13.200 9.240 N GOT1 n/a
6 TRCN0000294120 TGCCTGGGCCATTCGCTATTT pLKO_005 770 CDS 100% 13.200 9.240 N GOT1 n/a
7 TRCN0000034784 GCGTTGGTACAATGGAACAAA pLKO.1 422 CDS 100% 5.625 3.938 N GOT1 n/a
8 TRCN0000286724 GCGTTGGTACAATGGAACAAA pLKO_005 422 CDS 100% 5.625 3.938 N GOT1 n/a
9 TRCN0000034786 CCCTTCTTTGACTCAGCCTAT pLKO.1 717 CDS 100% 4.050 2.835 N GOT1 n/a
10 TRCN0000034787 GCAGGTTGAGTATCTGGTCAA pLKO.1 1166 CDS 100% 4.050 2.835 N GOT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002079.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00665 pDONR223 98.8% 100% 100% None n/a
2 ccsbBroad304_00665 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV