Transcript: Human NM_002108.4

Homo sapiens histidine ammonia-lyase (HAL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HAL (3034)
Length:
3892
CDS:
349..2322

Additional Resources:

NCBI RefSeq record:
NM_002108.4
NBCI Gene record:
HAL (3034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078282 GCATCCATGAACTTGCTGCAA pLKO.1 1724 CDS 100% 2.640 3.696 N HAL n/a
2 TRCN0000427373 GGTGTGGTGAATGATACAATA pLKO_005 1561 CDS 100% 13.200 10.560 N HAL n/a
3 TRCN0000222705 CCCTCAAACAAGTCATAGAAA pLKO.1 1034 CDS 100% 5.625 4.500 N HAL n/a
4 TRCN0000078278 GCCTTAATATGCCTTCATAAA pLKO.1 2795 3UTR 100% 13.200 9.240 N HAL n/a
5 TRCN0000431710 GGTCATAGATAGCATCATAAA pLKO_005 801 CDS 100% 13.200 9.240 N HAL n/a
6 TRCN0000078281 CCAAAGGATACAGTGGCATTT pLKO.1 1004 CDS 100% 10.800 7.560 N HAL n/a
7 TRCN0000078280 CCTGACTTCATTCCATCTCAA pLKO.1 619 CDS 100% 4.950 3.465 N HAL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06350 pDONR223 100% 99.9% 99.8% None 1315G>A n/a
2 ccsbBroad304_06350 pLX_304 0% 99.9% 99.8% V5 1315G>A n/a
3 TRCN0000471830 AGGAGCATCGCCCTTGGGTCGAAA pLX_317 25% 99.9% 99.8% V5 1315G>A n/a
Download CSV