Transcript: Human NM_002163.4

Homo sapiens interferon regulatory factor 8 (IRF8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
IRF8 (3394)
Length:
2668
CDS:
64..1344

Additional Resources:

NCBI RefSeq record:
NM_002163.4
NBCI Gene record:
IRF8 (3394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002163.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435466 CAGATAGCTGCTTCGATAAAG pLKO_005 1685 3UTR 100% 13.200 18.480 N IRF8 n/a
2 TRCN0000020988 GCCTCACACCAGAGATCATTT pLKO.1 1294 CDS 100% 13.200 18.480 N IRF8 n/a
3 TRCN0000020984 GCCCGCATCATGATTAAAGAA pLKO.1 1404 3UTR 100% 5.625 7.875 N IRF8 n/a
4 TRCN0000020985 CCATACAAAGTTTACCGAATT pLKO.1 379 CDS 100% 0.000 0.000 N IRF8 n/a
5 TRCN0000429151 ACGCTGGCAAGCAAGATTATA pLKO_005 188 CDS 100% 15.000 10.500 N IRF8 n/a
6 TRCN0000020987 GCATGTATCCAGGACTGATTT pLKO.1 125 CDS 100% 13.200 9.240 N IRF8 n/a
7 TRCN0000020986 GCTTTGAATAAGAGCCCAGAT pLKO.1 316 CDS 100% 4.050 2.835 N IRF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002163.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00814 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00814 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479153 CAGCTTATAAAAGTATTGATGTTG pLX_317 36.5% 100% 100% V5 n/a
Download CSV