Transcript: Human NM_002168.3

Homo sapiens isocitrate dehydrogenase (NADP(+)) 2 (IDH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
IDH2 (3418)
Length:
1818
CDS:
165..1523

Additional Resources:

NCBI RefSeq record:
NM_002168.3
NBCI Gene record:
IDH2 (3418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229434 TGATGAGATGACCCGTATTAT pLKO_005 329 CDS 100% 15.000 21.000 N IDH2 n/a
2 TRCN0000219071 ATCTTTGACAAGCACTATAAG pLKO_005 969 CDS 100% 13.200 18.480 N IDH2 n/a
3 TRCN0000429789 ATCTTTGACAAGCACTATAAG pLKO_005 969 CDS 100% 13.200 18.480 N Idh2 n/a
4 TRCN0000220369 CGACTTCGACAAGAATAAGAT pLKO.1 992 CDS 100% 5.625 7.875 N IDH2 n/a
5 TRCN0000220371 GTGGACATCCAGCTAAAGTAT pLKO.1 387 CDS 100% 5.625 7.875 N IDH2 n/a
6 TRCN0000220368 CCGTATTATCTGGCAGTTCAT pLKO.1 341 CDS 100% 4.950 6.930 N IDH2 n/a
7 TRCN0000220370 GCTGTACATGAGCACCAAGAA pLKO.1 899 CDS 100% 4.950 3.960 N IDH2 n/a
8 TRCN0000220372 TGCAAGAACTATGACGGAGAT pLKO.1 1086 CDS 100% 4.050 3.240 N IDH2 n/a
9 TRCN0000229435 CCACGTGGACATCCAGCTAAA pLKO_005 383 CDS 100% 10.800 7.560 N IDH2 n/a
10 TRCN0000229778 CCAAGAACACCATACTGAAAG pLKO_005 913 CDS 100% 10.800 6.480 N IDH2 n/a
11 TRCN0000229779 CCTCTCTGGAGGCCTTTCTAG pLKO_005 1612 3UTR 100% 1.650 0.990 N IDH2 n/a
12 TRCN0000041710 CCTCAGCAATGTGAAGCTGAA pLKO.1 1427 CDS 100% 0.405 0.243 N Idh2 n/a
13 TRCN0000041712 GAAGAGTTCAAGCTGAAGAAA pLKO.1 534 CDS 100% 5.625 3.938 N Idh2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00817 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00817 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466032 CCCCTTCTCACCGTGAGCAATTGG pLX_317 22.9% 100% 100% V5 n/a
Download CSV