Transcript: Human NM_002220.3

Homo sapiens inositol-trisphosphate 3-kinase A (ITPKA), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ITPKA (3706)
Length:
1825
CDS:
55..1440

Additional Resources:

NCBI RefSeq record:
NM_002220.3
NBCI Gene record:
ITPKA (3706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037568 TGGTCAATCTGCCGGTCATAA pLKO.1 572 CDS 100% 13.200 18.480 N ITPKA n/a
2 TRCN0000037565 GCCGGTCATAAGCCCTTTCAA pLKO.1 582 CDS 100% 5.625 7.875 N ITPKA n/a
3 TRCN0000199451 GCGTCAGGACTTACCTAGAGG pLKO.1 851 CDS 100% 0.880 1.232 N ITPKA n/a
4 TRCN0000199062 CCTTTCCACCTCGTCGGTCTC pLKO.1 411 CDS 100% 0.000 0.000 N ITPKA n/a
5 TRCN0000037566 CCTTGTGTGCTCGACTGCAAA pLKO.1 826 CDS 100% 4.950 3.465 N ITPKA n/a
6 TRCN0000037564 GCTTCGCGTCTTTGAAGAGTT pLKO.1 1119 CDS 100% 4.950 3.465 N ITPKA n/a
7 TRCN0000037567 GAAGAGTTTGTGCAAGGAGAT pLKO.1 1132 CDS 100% 4.050 2.835 N ITPKA n/a
8 TRCN0000025556 GCTGGACAATCTCATTGGCAT pLKO.1 1395 CDS 100% 2.640 1.848 N Itpka n/a
9 TRCN0000199814 GCCGCTCACCTGACATGTGGA pLKO.1 1463 3UTR 100% 0.000 0.000 N ITPKA n/a
10 TRCN0000194935 CGGAAGGACATGTACAAGAAA pLKO.1 907 CDS 100% 5.625 3.375 N ITPKA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488971 AATTTTGGCCGCCAAAAATCGGTC pLX_317 26.1% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV