Transcript: Human NM_002246.3

Homo sapiens potassium two pore domain channel subfamily K member 3 (KCNK3), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
KCNK3 (3777)
Length:
6191
CDS:
155..1339

Additional Resources:

NCBI RefSeq record:
NM_002246.3
NBCI Gene record:
KCNK3 (3777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043752 CTACGAGCACTGGACCTTCTT pLKO.1 694 CDS 100% 4.950 6.930 N KCNK3 n/a
2 TRCN0000427221 TCACGCTCGTCATGTTCCAGA pLKO_005 513 CDS 100% 2.640 3.696 N KCNK3 n/a
3 TRCN0000433522 GTACGTTTGCATCTCTATTTA pLKO_005 1704 3UTR 100% 15.000 10.500 N KCNK3 n/a
4 TRCN0000043751 CATCAACACCTTGGTGAGGTA pLKO.1 547 CDS 100% 2.640 1.848 N KCNK3 n/a
5 TRCN0000043749 GTGGTACAAGAGCCGCGAGAA pLKO.1 1093 CDS 100% 1.350 0.945 N KCNK3 n/a
6 TRCN0000043748 GCTGCGCTTCATGACCATGAA pLKO.1 883 CDS 100% 0.495 0.347 N KCNK3 n/a
7 TRCN0000043750 GCTGCGCCTCAAGCCGCACAA pLKO.1 352 CDS 100% 0.000 0.000 N KCNK3 n/a
8 TRCN0000423723 CCACCTTCCCTTGGTTCCAAA pLKO_005 1747 3UTR 100% 4.950 2.970 N KCNK3 n/a
9 TRCN0000070055 CATCGTGTGCACCTTCACCTA pLKO.1 187 CDS 100% 2.640 1.584 N LOC384294 n/a
10 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 4144 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.