Transcript: Human NM_002266.4

Homo sapiens karyopherin subunit alpha 2 (KPNA2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
KPNA2 (3838)
Length:
1977
CDS:
130..1719

Additional Resources:

NCBI RefSeq record:
NM_002266.4
NBCI Gene record:
KPNA2 (3838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065309 GCTGGTTTGATTCCGAAATTT pLKO.1 481 CDS 100% 15.000 21.000 N KPNA2 n/a
2 TRCN0000286475 GCTGGTTTGATTCCGAAATTT pLKO_005 481 CDS 100% 15.000 21.000 N KPNA2 n/a
3 TRCN0000381808 GCATGTGGCTACTTACGTAAT pLKO_005 793 CDS 100% 10.800 15.120 N KPNA2 n/a
4 TRCN0000380163 ACATTGTCAAAGGCATAAATA pLKO_005 368 CDS 100% 15.000 10.500 N KPNA2 n/a
5 TRCN0000382469 TGTGGGCCGTGACCAACTATA pLKO_005 1322 CDS 100% 13.200 9.240 N KPNA2 n/a
6 TRCN0000065308 CCTGGACACTTTCTAATCTTT pLKO.1 818 CDS 100% 5.625 3.938 N KPNA2 n/a
7 TRCN0000286543 CCTGGACACTTTCTAATCTTT pLKO_005 818 CDS 100% 5.625 3.938 N KPNA2 n/a
8 TRCN0000065310 CGAATTGGCATGGTGGTGAAA pLKO.1 982 CDS 100% 4.950 3.465 N KPNA2 n/a
9 TRCN0000065311 GATGACATTGTCAAAGGCATA pLKO.1 364 CDS 100% 4.050 2.835 N KPNA2 n/a
10 TRCN0000293910 TCATGTAGCTGAGACATAAAT pLKO_005 1721 3UTR 100% 15.000 9.000 N KPNA2 n/a
11 TRCN0000293909 CTTGTTCACTGTGGCATAATA pLKO_005 1375 CDS 100% 15.000 7.500 Y KPNA2 n/a
12 TRCN0000065312 CTACCTCTGAAGGCTACACTT pLKO.1 1658 CDS 100% 4.950 2.475 Y KPNA2 n/a
13 TRCN0000298241 CTACCTCTGAAGGCTACACTT pLKO_005 1658 CDS 100% 4.950 2.475 Y KPNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06500 pDONR223 100% 99.8% 99.6% None 651T>G;730C>N;801A>G n/a
2 ccsbBroad304_06500 pLX_304 0% 99.8% 99.6% V5 651T>G;730C>N;801A>G n/a
3 TRCN0000491681 ACACTGAACAATCCAGAGAGTTCA pLX_317 19.7% 99.8% 99.6% V5 651T>G;730C>N;801A>G n/a
4 ccsbBroadEn_06499 pDONR223 100% 99.8% 99.6% None 470C>T;1152T>C;1359A>C n/a
5 ccsbBroad304_06499 pLX_304 0% 99.8% 99.6% V5 470C>T;1152T>C;1359A>C n/a
6 TRCN0000466319 GCTCTTGCTCTGCGATCATTGGTA pLX_317 27.2% 99.8% 99.6% V5 470C>T;1152T>C;1359A>C n/a
7 ccsbBroadEn_06501 pDONR223 100% 99.8% 99.6% None 494C>G;545C>A;801A>G n/a
8 ccsbBroad304_06501 pLX_304 0% 99.8% 99.6% V5 494C>G;545C>A;801A>G n/a
9 TRCN0000469404 TTATCCCTTGGCTCGCCAGAATCG pLX_317 24.8% 99.8% 99.6% V5 494C>G;545C>A;801A>G n/a
Download CSV