Transcript: Human NM_002298.5

Homo sapiens lymphocyte cytosolic protein 1 (LCP1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LCP1 (3936)
Length:
3643
CDS:
92..1975

Additional Resources:

NCBI RefSeq record:
NM_002298.5
NBCI Gene record:
LCP1 (3936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002298.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422371 TAGAAGCTGCAGTGGTATTAA pLKO_005 2281 3UTR 100% 15.000 21.000 N LCP1 n/a
2 TRCN0000429857 ACTGAATATCCTCGAAGAAAT pLKO_005 1600 CDS 100% 13.200 18.480 N LCP1 n/a
3 TRCN0000056494 CCTGGGTATAGAGTACGAGAA pLKO.1 227 CDS 100% 4.050 5.670 N LCP1 n/a
4 TRCN0000056496 GTCATCAAGATTGGGTTGTTT pLKO.1 782 CDS 100% 5.625 4.500 N LCP1 n/a
5 TRCN0000056493 GCGGACATTTAGGAACTGGAT pLKO.1 1282 CDS 100% 2.640 2.112 N LCP1 n/a
6 TRCN0000412275 GTTTCAAGGACCCGAAGATTA pLKO_005 1710 CDS 100% 13.200 9.240 N LCP1 n/a
7 TRCN0000056495 CCAACCAGGTTCCATTAACTA pLKO.1 1768 CDS 100% 5.625 3.938 N LCP1 n/a
8 TRCN0000056497 CAGAGTAAACAAACCGCCATA pLKO.1 1411 CDS 100% 4.050 2.835 N LCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002298.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06517 pDONR223 100% 99.9% 99.8% None 1597A>G n/a
2 ccsbBroad304_06517 pLX_304 0% 99.9% 99.8% V5 1597A>G n/a
3 TRCN0000474511 AGTCCACCCGGTGTGAGGAGTATT pLX_317 30.2% 99.9% 99.8% V5 1597A>G n/a
Download CSV