Transcript: Human NM_002318.3

Homo sapiens lysyl oxidase like 2 (LOXL2), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
LOXL2 (4017)
Length:
3721
CDS:
251..2575

Additional Resources:

NCBI RefSeq record:
NM_002318.3
NBCI Gene record:
LOXL2 (4017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046195 CGATTACTCCAACAACATCAT pLKO.1 2419 CDS 100% 4.950 3.960 N LOXL2 n/a
2 TRCN0000359075 GAAACCCTCCAGTCTATTATA pLKO_005 3059 3UTR 100% 15.000 10.500 N LOXL2 n/a
3 TRCN0000358994 GGCAATGAGAAGTCCATTATA pLKO_005 1439 CDS 100% 15.000 10.500 N LOXL2 n/a
4 TRCN0000046193 CCAGATAGAGAACCTGAATAT pLKO.1 772 CDS 100% 13.200 9.240 N LOXL2 n/a
5 TRCN0000358992 CTACCTGTTCCAGGTTGTTAT pLKO_005 2371 CDS 100% 13.200 9.240 N LOXL2 n/a
6 TRCN0000046197 GAAGGAGACATCCAGAAGAAT pLKO.1 2240 CDS 100% 5.625 3.938 N LOXL2 n/a
7 TRCN0000046194 CCTGGGTTCAAATTTGACAAT pLKO.1 740 CDS 100% 4.950 3.465 N LOXL2 n/a
8 TRCN0000046196 GAGAGGACATACAATACCAAA pLKO.1 965 CDS 100% 4.950 3.465 N LOXL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489515 TGGACACTCACAATCAATGCAGAT pLX_317 12.7% 99.8% 99.8% V5 (not translated due to prior stop codon) 939A>G;1038A>G;1708A>C n/a
2 TRCN0000488025 TTGTTCGGACCCTTCATACATCTA pLX_317 13.1% 99.8% 99.7% V5 (many diffs) n/a
Download CSV