Transcript: Human NM_002364.5

Homo sapiens MAGE family member B2 (MAGEB2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MAGEB2 (4113)
Length:
1607
CDS:
99..1058

Additional Resources:

NCBI RefSeq record:
NM_002364.5
NBCI Gene record:
MAGEB2 (4113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135902 GTCCGTTACAAAGGGAGAAAT pLKO.1 488 CDS 100% 13.200 18.480 N MAGEB2 n/a
2 TRCN0000432771 ACTAAGAGCCCAAGCGAAGAT pLKO_005 405 CDS 100% 4.950 6.930 N MAGEB2 n/a
3 TRCN0000136390 CAACCCATTACGAAGAAGCTT pLKO.1 1009 CDS 100% 3.000 2.400 N MAGEB2 n/a
4 TRCN0000416821 AGTGTTTCAACAGGTTTATTT pLKO_005 1250 3UTR 100% 15.000 10.500 N MAGEB2 n/a
5 TRCN0000427433 TGATATAGATCACCCTGTTAT pLKO_005 1295 3UTR 100% 13.200 9.240 N MAGEB2 n/a
6 TRCN0000135149 CAATCTCCCAAAGCCAAGTTT pLKO.1 1101 3UTR 100% 5.625 3.938 N MAGEB2 n/a
7 TRCN0000136507 CAGGGACAGTAGAAAGTGTTT pLKO.1 1326 3UTR 100% 4.950 3.465 N MAGEB2 n/a
8 TRCN0000134889 CCTTGAGCTGAATAAAGTCAA pLKO.1 593 CDS 100% 4.950 3.465 N MAGEB2 n/a
9 TRCN0000136357 CCTGGGTGTGATCTTCTTAAA pLKO.1 719 CDS 100% 13.200 6.600 Y MAGEB2 n/a
10 TRCN0000136316 CAAGATGAAAGTCCTGGAGTT pLKO.1 950 CDS 100% 4.050 2.025 Y MAGEB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06554 pDONR223 100% 99.6% 99.6% None 181G>A;216G>A;306C>T n/a
2 ccsbBroad304_06554 pLX_304 0% 99.6% 99.6% V5 181G>A;216G>A;306C>T n/a
3 TRCN0000473470 ACACGAGCCGGCTATAACCGGGAA pLX_317 40.3% 99.6% 99.6% V5 181G>A;216G>A;306C>T n/a
Download CSV