Transcript: Human NM_002385.3

Homo sapiens myelin basic protein (MBP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MBP (4155)
Length:
2202
CDS:
48..608

Additional Resources:

NCBI RefSeq record:
NM_002385.3
NBCI Gene record:
MBP (4155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116258 CGTAGTCCACTTCTTCAAGAA pLKO.1 383 CDS 100% 4.950 6.930 N MBP n/a
2 TRCN0000116257 GCCTCGATGATGAGAGAGTTA pLKO.1 1996 3UTR 100% 4.950 6.930 N MBP n/a
3 TRCN0000116260 CCCGGCAAGAACTGCTCACTA pLKO.1 314 CDS 100% 1.650 1.320 N MBP n/a
4 TRCN0000090247 ACAGCAAGTACCATGGACCAT pLKO.1 99 CDS 100% 2.640 1.848 N Mbp n/a
5 TRCN0000116259 CGGAGGCAGAGCGTCCGACTA pLKO.1 476 CDS 100% 0.000 0.000 N MBP n/a
6 TRCN0000116261 CCTGGCCACAGCAAGTACCAT pLKO.1 92 CDS 100% 1.000 0.600 N MBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00981 pDONR223 100% 19.6% 18.8% None (many diffs) n/a
2 ccsbBroad304_00981 pLX_304 0% 19.6% 18.8% V5 (many diffs) n/a
3 TRCN0000481619 TTCGGATGTTAAATAACATACGCA pLX_317 75.9% 19.6% 18.8% V5 (many diffs) n/a
Download CSV