Transcript: Human NM_002434.4

Homo sapiens N-methylpurine DNA glycosylase (MPG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MPG (4350)
Length:
1229
CDS:
264..1160

Additional Resources:

NCBI RefSeq record:
NM_002434.4
NBCI Gene record:
MPG (4350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002434.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431061 ATTTCTGGGACAGGTCCTAGT pLKO_005 566 CDS 100% 4.050 5.670 N MPG n/a
2 TRCN0000427047 GGGTTGGAGTTCTTCGACCAG pLKO_005 522 CDS 100% 0.720 1.008 N MPG n/a
3 TRCN0000051250 GTACATCATTTACGGCATGTA pLKO.1 737 CDS 100% 0.495 0.396 N MPG n/a
4 TRCN0000051252 CCCATACCGCAGCATCTATTT pLKO.1 470 CDS 100% 13.200 9.240 N MPG n/a
5 TRCN0000051251 CCTGTACGTGTACATCATTTA pLKO.1 728 CDS 100% 13.200 9.240 N MPG n/a
6 TRCN0000051249 CGACTTCCTAATGGCACAGAA pLKO.1 591 CDS 100% 4.950 3.465 N MPG n/a
7 TRCN0000051248 CATCTATTTCTCAAGCCCAAA pLKO.1 482 CDS 100% 4.050 2.835 N MPG n/a
8 TRCN0000413887 GGATGAAGCTGTATGGCTGGA pLKO_005 977 CDS 100% 2.160 1.512 N MPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002434.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01031 pDONR223 100% 97.7% 95.9% None (many diffs) n/a
2 ccsbBroad304_01031 pLX_304 0% 97.7% 95.9% V5 (many diffs) n/a
3 TRCN0000465256 TGGGTTGCTTGTCCAAACATGATT pLX_317 34.1% 97.7% 95.9% V5 (many diffs) n/a
Download CSV