Transcript: Human NM_002440.4

Homo sapiens mutS homolog 4 (MSH4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MSH4 (4438)
Length:
3270
CDS:
105..2915

Additional Resources:

NCBI RefSeq record:
NM_002440.4
NBCI Gene record:
MSH4 (4438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428187 ATTAGAGCCTCTAGTTGATAT pLKO_005 1169 CDS 100% 13.200 18.480 N MSH4 n/a
2 TRCN0000436119 GGAGGTTCAGTCCAAGTATTA pLKO_005 905 CDS 100% 13.200 18.480 N MSH4 n/a
3 TRCN0000151332 GCTAATGACAAATCGCTCATA pLKO.1 2352 CDS 100% 4.950 6.930 N MSH4 n/a
4 TRCN0000152238 CCAGATGACTACAGATTGTAT pLKO.1 1721 CDS 100% 5.625 4.500 N MSH4 n/a
5 TRCN0000152936 GAGGTGAAATAGGAATGGCAA pLKO.1 607 CDS 100% 2.640 2.112 N MSH4 n/a
6 TRCN0000151861 CTTCTGCACGAGATACTAATT pLKO.1 424 CDS 100% 13.200 9.240 N MSH4 n/a
7 TRCN0000151661 GCAGGAATGATATCACAACTT pLKO.1 1641 CDS 100% 4.950 3.465 N MSH4 n/a
8 TRCN0000151052 GCCAAGAATCTTTGAGAGAAA pLKO.1 1846 CDS 100% 4.950 3.465 N MSH4 n/a
9 TRCN0000151529 CCATCAGTTATTGTAGCTGTT pLKO.1 564 CDS 100% 4.050 2.835 N MSH4 n/a
10 TRCN0000265011 AGGACTTGCCAGAGGTGAATG pLKO_005 596 CDS 100% 10.800 5.400 Y Fam131a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06595 pDONR223 100% 99.8% 99.8% None (many diffs) n/a
2 ccsbBroad304_06595 pLX_304 0% 99.8% 99.8% V5 (many diffs) n/a
3 TRCN0000468998 GATCAATTTTACTAGCCCCCCCCA pLX_317 3.8% 99.8% 99.8% V5 (many diffs) n/a
Download CSV