Transcript: Human NM_002449.5

Homo sapiens msh homeobox 2 (MSX2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MSX2 (4488)
Length:
2195
CDS:
79..882

Additional Resources:

NCBI RefSeq record:
NM_002449.5
NBCI Gene record:
MSX2 (4488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002449.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234852 ATGTGCTAAAGTCAATGATTT pLKO_005 1323 3UTR 100% 13.200 9.240 N MSX2 n/a
2 TRCN0000020437 CGTCCATATATGGAGCATCCT pLKO.1 776 CDS 100% 2.640 1.848 N MSX2 n/a
3 TRCN0000020438 TCCGTCAGAAACAGTACCTCT pLKO.1 560 CDS 100% 2.640 1.848 N MSX2 n/a
4 TRCN0000234848 AGCGCAAGTTCCGTCAGAAAC pLKO_005 551 CDS 100% 10.800 6.480 N MSX2 n/a
5 TRCN0000020435 CTGAGGAAACACAAGACCAAT pLKO.1 484 CDS 100% 4.950 2.970 N MSX2 n/a
6 TRCN0000020434 GCCCATTAAGTTCCCTGGTAT pLKO.1 2018 3UTR 100% 4.950 2.970 N MSX2 n/a
7 TRCN0000070633 CCTGAGGAAACACAAGACCAA pLKO.1 483 CDS 100% 2.640 1.584 N Msx2 n/a
8 TRCN0000234849 TGCAGGCAGCGTCCATATATG pLKO_005 767 CDS 100% 13.200 6.600 Y MSX2 n/a
9 TRCN0000234851 TAAGGAAGACCAGATCAATAG pLKO_005 880 CDS 100% 10.800 5.400 Y MSX2 n/a
10 TRCN0000234850 TATGCCACGCCAGTGGGATAT pLKO_005 841 CDS 100% 10.800 5.400 Y MSX2 n/a
11 TRCN0000020436 CCGTTCCATAGACCTGTGCTT pLKO.1 799 CDS 100% 2.640 1.320 Y MSX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002449.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06597 pDONR223 100% 99.8% 99.6% None 386T>C n/a
2 ccsbBroad304_06597 pLX_304 0% 99.8% 99.6% V5 386T>C n/a
3 TRCN0000471846 ACTTCCCCTTAACCTATTTACGTA pLX_317 61.6% 99.8% 99.6% V5 386T>C n/a
Download CSV