Transcript: Human NM_002484.4

Homo sapiens nucleotide binding protein 1 (NUBP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
NUBP1 (4682)
Length:
1231
CDS:
23..985

Additional Resources:

NCBI RefSeq record:
NM_002484.4
NBCI Gene record:
NUBP1 (4682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002484.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186807 GCTCTTCTAGACATCGATATA pLKO.1 284 CDS 100% 13.200 18.480 N NUBP1 n/a
2 TRCN0000319029 GCTCTTCTAGACATCGATATA pLKO_005 284 CDS 100% 13.200 18.480 N NUBP1 n/a
3 TRCN0000160771 CCGCTCATAGGTAAGAATTGT pLKO.1 833 CDS 100% 5.625 7.875 N NUBP1 n/a
4 TRCN0000349662 CCGCTCATAGGTAAGAATTGT pLKO_005 833 CDS 100% 5.625 7.875 N NUBP1 n/a
5 TRCN0000204019 GATCCGCTCATAGGTAAGAAT pLKO.1 830 CDS 100% 5.625 3.938 N NUBP1 n/a
6 TRCN0000185078 CATAGGTAAGAATTGTGACAA pLKO.1 838 CDS 100% 4.950 3.465 N NUBP1 n/a
7 TRCN0000162529 CCCAAGATAATGGGATTGGAA pLKO.1 320 CDS 100% 3.000 2.100 N NUBP1 n/a
8 TRCN0000319103 CCCAAGATAATGGGATTGGAA pLKO_005 320 CDS 100% 3.000 2.100 N NUBP1 n/a
9 TRCN0000188806 CGAGAGAATGTTCAGGACCAA pLKO.1 988 3UTR 100% 2.640 1.848 N NUBP1 n/a
10 TRCN0000349663 CGAGAGAATGTTCAGGACCAA pLKO_005 988 3UTR 100% 2.640 1.848 N NUBP1 n/a
11 TRCN0000158929 GATTCCCAAGATAATGGGATT pLKO.1 316 CDS 100% 0.405 0.243 N NUBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002484.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10988 pDONR223 100% 96.5% 96.5% None 327_359del n/a
2 ccsbBroad304_10988 pLX_304 0% 96.5% 96.5% V5 327_359del n/a
3 TRCN0000477882 AGACTGTTTACCAAGGGGTCAGGT pLX_317 23.5% 96.5% 96.5% V5 327_359del n/a
Download CSV