Transcript: Human NM_002517.4

Homo sapiens neuronal PAS domain protein 1 (NPAS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
NPAS1 (4861)
Length:
2100
CDS:
204..1976

Additional Resources:

NCBI RefSeq record:
NM_002517.4
NBCI Gene record:
NPAS1 (4861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002517.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015291 CCTTCTTTGTCCGCATGAAAT pLKO.1 940 CDS 100% 13.200 18.480 N NPAS1 n/a
2 TRCN0000015289 CCATGGACACATGATCGTCTT pLKO.1 1103 CDS 100% 4.050 5.670 N NPAS1 n/a
3 TRCN0000015292 TGGCTTTGTGTTCGCCTTGAA pLKO.1 644 CDS 100% 4.950 3.465 N NPAS1 n/a
4 TRCN0000015290 GCCCGAGTTCACCTCTGTCAT pLKO.1 1676 CDS 100% 1.650 1.155 N NPAS1 n/a
5 TRCN0000015288 CCAAACTCCTTTGGATGCCTT pLKO.1 1436 CDS 100% 0.264 0.185 N NPAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002517.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06652 pDONR223 100% 99.9% 100% None 306G>T n/a
2 ccsbBroad304_06652 pLX_304 0% 99.9% 100% V5 306G>T n/a
3 TRCN0000475664 ATCTCGCGCCACCCTAAGAATCAA pLX_317 8.4% 99.9% 100% V5 306G>T n/a
Download CSV