Transcript: Human NM_002557.4

Homo sapiens oviductal glycoprotein 1 (OVGP1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
OVGP1 (5016)
Length:
2196
CDS:
15..2051

Additional Resources:

NCBI RefSeq record:
NM_002557.4
NBCI Gene record:
OVGP1 (5016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052088 GCCCATAAACTCGTGTGTTAT pLKO.1 75 CDS 100% 13.200 18.480 N OVGP1 n/a
2 TRCN0000412793 TGTCTACGTATTGAATGATAT pLKO_005 1136 CDS 100% 13.200 18.480 N OVGP1 n/a
3 TRCN0000052089 CGGAACAAACTCCTCTAGCTT pLKO.1 1906 CDS 100% 3.000 4.200 N OVGP1 n/a
4 TRCN0000419137 AGTTACAAGGCATGGTTTATA pLKO_005 1026 CDS 100% 15.000 12.000 N OVGP1 n/a
5 TRCN0000052092 GCACTGGATTGATTACCAGTA pLKO.1 947 CDS 100% 0.405 0.324 N OVGP1 n/a
6 TRCN0000430782 CCCTACAAAGGAAACTGTATC pLKO_005 1370 CDS 100% 10.800 7.560 N OVGP1 n/a
7 TRCN0000421163 ATCGTCCAAACATCCTATGAT pLKO_005 585 CDS 100% 5.625 3.938 N OVGP1 n/a
8 TRCN0000052090 CCTGGATTTCATCAATGTCTT pLKO.1 626 CDS 100% 4.950 3.465 N OVGP1 n/a
9 TRCN0000052091 GCACCTCAAGATTCACCACTA pLKO.1 322 CDS 100% 4.050 2.835 N OVGP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01129 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01129 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476409 GATGTAACCTAGAAGAGCGCGGAA pLX_317 18.8% 100% 100% V5 n/a
Download CSV