Transcript: Human NM_002584.3

Homo sapiens paired box 7 (PAX7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-18
Taxon:
Homo sapiens (human)
Gene:
PAX7 (5081)
Length:
2420
CDS:
759..2321

Additional Resources:

NCBI RefSeq record:
NM_002584.3
NBCI Gene record:
PAX7 (5081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427926 GTGCAGGTCTGGTTCAGTAAC pLKO_005 1539 CDS 100% 10.800 15.120 N PAX7 n/a
2 TRCN0000075380 CAGAATCAAGTTCGGGAAGAA pLKO.1 1238 CDS 100% 4.950 6.930 N Pax7 n/a
3 TRCN0000427658 GCGACTCCGGATGTAGAGAAA pLKO_005 1086 CDS 100% 4.950 6.930 N PAX7 n/a
4 TRCN0000018277 TCAGGTTTAGTGAGTTCGATT pLKO.1 1206 CDS 100% 4.950 6.930 N PAX7 n/a
5 TRCN0000018276 CGGCTATCAGTACGGCCAGTA pLKO.1 2132 CDS 100% 1.350 1.890 N PAX7 n/a
6 TRCN0000018274 CTGCTTGTTTATGGAGAGCTA pLKO.1 2222 CDS 100% 2.640 1.848 N PAX7 n/a
7 TRCN0000018273 GCTCAGAATCAAGTTCGGGAA pLKO.1 1235 CDS 100% 2.160 1.512 N PAX7 n/a
8 TRCN0000018275 CGCACGGGATTCCCTTTGGAA pLKO.1 822 CDS 100% 1.000 0.700 N PAX7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002584.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06690 pDONR223 100% 99.5% 99.6% None 450_455delAGGTTT;879A>G n/a
2 ccsbBroad304_06690 pLX_304 0% 99.5% 99.6% V5 450_455delAGGTTT;879A>G n/a
3 TRCN0000492183 TTGATGCCCTACTATAACCCTTAC pLX_317 25.7% 99.5% 99.6% V5 450_455delAGGTTT;879A>G n/a
Download CSV