Transcript: Human NM_002653.5

Homo sapiens paired like homeodomain 1 (PITX1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PITX1 (5307)
Length:
2337
CDS:
348..1292

Additional Resources:

NCBI RefSeq record:
NM_002653.5
NBCI Gene record:
PITX1 (5307)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020463 CTCGGGCCTCAACAACATCAA pLKO.1 1064 CDS 100% 4.950 6.930 N PITX1 n/a
2 TRCN0000020460 TCCAAACAGCACTCGTCGTTT pLKO.1 1212 CDS 100% 4.950 6.930 N PITX1 n/a
3 TRCN0000020459 AGTTGCAATTTCTCTCGGGAT pLKO.1 1563 3UTR 100% 2.160 3.024 N PITX1 n/a
4 TRCN0000425220 CAACGTACGCACTTCACAAGC pLKO_005 621 CDS 100% 4.050 3.240 N PITX1 n/a
5 TRCN0000418245 GCCTGGACTTGCCTAGGATTT pLKO_005 1758 3UTR 100% 10.800 7.560 N PITX1 n/a
6 TRCN0000415860 TCAACGCGTGCCAGTACAACA pLKO_005 1267 CDS 100% 4.950 3.465 N PITX1 n/a
7 TRCN0000020461 GCAAGAGCTAGAGGCCACGTT pLKO.1 650 CDS 100% 0.880 0.616 N PITX1 n/a
8 TRCN0000020462 GCCGCTCTCCACCAAGAGCTT pLKO.1 923 CDS 100% 0.000 0.000 N PITX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01209 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01209 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470178 AACCTTAGACTCTTCCGCTCCCTT pLX_317 36.6% 100% 100% V5 n/a
Download CSV