Transcript: Human NM_002664.3

Homo sapiens pleckstrin (PLEK), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PLEK (5341)
Length:
2760
CDS:
71..1123

Additional Resources:

NCBI RefSeq record:
NM_002664.3
NBCI Gene record:
PLEK (5341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002664.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056176 CCATTGACTTAGGTGCCTTAT pLKO.1 438 CDS 100% 10.800 15.120 N PLEK n/a
2 TRCN0000056177 AGGAAGTTCATCTTGAGAGAA pLKO.1 860 CDS 100% 4.950 3.960 N PLEK n/a
3 TRCN0000056173 GCCTTATATTTGTCCATGAAA pLKO.1 452 CDS 100% 5.625 3.938 N PLEK n/a
4 TRCN0000056175 CCTTGTCAAGACTTTGGCAAA pLKO.1 242 CDS 100% 4.050 2.835 N PLEK n/a
5 TRCN0000091062 GCCTACCTGCACTACTATGAT pLKO.1 887 CDS 100% 5.625 7.875 N Plek n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002664.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06738 pDONR223 100% 99.9% 99.7% None 1019G>A n/a
2 ccsbBroad304_06738 pLX_304 0% 99.9% 99.7% V5 1019G>A n/a
Download CSV