Transcript: Human NM_002874.5

Homo sapiens RAD23 homolog B, nucleotide excision repair protein (RAD23B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RAD23B (5887)
Length:
4114
CDS:
352..1581

Additional Resources:

NCBI RefSeq record:
NM_002874.5
NBCI Gene record:
RAD23B (5887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002874.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127123 GATACTGCTCTCAAAGAATAT pLKO.1 517 CDS 100% 13.200 9.240 N Rad23b n/a
2 TRCN0000325303 GATACTGCTCTCAAAGAATAT pLKO_005 517 CDS 100% 13.200 9.240 N Rad23b n/a
3 TRCN0000003952 GTGTACTAGATCCAGAAACTT pLKO.1 1884 3UTR 100% 5.625 3.938 N RAD23B n/a
4 TRCN0000003955 CAGCAGATAGGTCGAGAGAAT pLKO.1 1261 CDS 100% 4.950 3.465 N RAD23B n/a
5 TRCN0000280042 CAGCAGATAGGTCGAGAGAAT pLKO_005 1261 CDS 100% 4.950 3.465 N RAD23B n/a
6 TRCN0000003951 CCAGCGTTACTACAGCAGATA pLKO.1 1249 CDS 100% 4.950 3.465 N RAD23B n/a
7 TRCN0000297359 CCAGCGTTACTACAGCAGATA pLKO_005 1249 CDS 100% 4.950 3.465 N RAD23B n/a
8 TRCN0000003954 CTCCAGCATCAGCGACAGCAT pLKO.1 731 CDS 100% 0.880 0.616 N RAD23B n/a
9 TRCN0000342712 CTCCAGCATCAGCGACAGCAT pLKO_005 731 CDS 100% 0.880 0.616 N RAD23B n/a
10 TRCN0000003953 AGAAGCTGGAAGTGGTCATAT pLKO.1 1401 CDS 100% 13.200 7.920 N RAD23B n/a
11 TRCN0000279797 AGAAGCTGGAAGTGGTCATAT pLKO_005 1401 CDS 100% 13.200 7.920 N RAD23B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002874.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06836 pDONR223 100% 99.8% 99.7% None 12C>T;746C>T n/a
2 ccsbBroad304_06836 pLX_304 46.9% 99.8% 99.7% V5 12C>T;746C>T n/a
3 TRCN0000467239 ATTCAGTTTTGCAGACGGGCGGCA pLX_317 24.7% 99.8% 99.7% V5 12C>T;746C>T n/a
Download CSV