Transcript: Human NM_002881.3

Homo sapiens RAS like proto-oncogene B (RALB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RALB (5899)
Length:
2247
CDS:
177..797

Additional Resources:

NCBI RefSeq record:
NM_002881.3
NBCI Gene record:
RALB (5899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002881.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072953 CGTGATGAGTTAAAGTTGTAT pLKO.1 1741 3UTR 100% 5.625 7.875 N RALB n/a
2 TRCN0000299771 CGTGATGAGTTAAAGTTGTAT pLKO_005 1741 3UTR 100% 5.625 7.875 N RALB n/a
3 TRCN0000072956 CAAGGTGTTCTTTGACCTAAT pLKO.1 674 CDS 100% 10.800 7.560 N RALB n/a
4 TRCN0000310519 CAAGGTGTTCTTTGACCTAAT pLKO_005 674 CDS 100% 10.800 7.560 N RALB n/a
5 TRCN0000072957 GAGTTTGTAGAAGACTATGAA pLKO.1 288 CDS 100% 5.625 3.938 N RALB n/a
6 TRCN0000299773 GAGTTTGTAGAAGACTATGAA pLKO_005 288 CDS 100% 5.625 3.938 N RALB n/a
7 TRCN0000072954 GCCATTCGAGATAACTACTTT pLKO.1 405 CDS 100% 5.625 3.938 N RALB n/a
8 TRCN0000299845 GCCATTCGAGATAACTACTTT pLKO_005 405 CDS 100% 5.625 3.938 N RALB n/a
9 TRCN0000072955 CCTTTACAGCAACTGCCGAAT pLKO.1 475 CDS 100% 4.050 2.835 N RALB n/a
10 TRCN0000299772 CCTTTACAGCAACTGCCGAAT pLKO_005 475 CDS 100% 4.050 2.835 N RALB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002881.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01372 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01372 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473581 TTGATCGTTGCTACCCGTAAGCGA pLX_317 84.6% 100% 100% V5 n/a
Download CSV