Transcript: Human NM_002884.3

Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
RAP1A (5906)
Length:
5028
CDS:
180..734

Additional Resources:

NCBI RefSeq record:
NM_002884.3
NBCI Gene record:
RAP1A (5906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055270 CAGTGGTGTAACTGTGCCTTT pLKO.1 588 CDS 100% 4.050 3.240 N Rap1a n/a
2 TRCN0000317279 CAGTGGTGTAACTGTGCCTTT pLKO_005 588 CDS 100% 4.050 3.240 N Rap1a n/a
3 TRCN0000029788 CCCAACGATAGAAGATTCCTA pLKO.1 278 CDS 100% 3.000 2.400 N RAP1A n/a
4 TRCN0000278853 CCCAACGATAGAAGATTCCTA pLKO_005 278 CDS 100% 3.000 2.400 N RAP1A n/a
5 TRCN0000347796 GACCTGGTCAGACAGATAAAT pLKO_005 657 CDS 100% 15.000 10.500 N Gm9392 n/a
6 TRCN0000029785 CGGAAGATGTTCCAATGATTT pLKO.1 496 CDS 100% 13.200 9.240 N RAP1A n/a
7 TRCN0000297568 CGGAAGATGTTCCAATGATTT pLKO_005 496 CDS 100% 13.200 9.240 N RAP1A n/a
8 TRCN0000029786 GCAAAGTCAAAGATCAATGTT pLKO.1 621 CDS 100% 5.625 3.938 N RAP1A n/a
9 TRCN0000278919 GCAAAGTCAAAGATCAATGTT pLKO_005 621 CDS 100% 5.625 3.938 N RAP1A n/a
10 TRCN0000029784 GCCAGCATTCCAGACTTCAAA pLKO.1 801 3UTR 100% 5.625 3.938 N RAP1A n/a
11 TRCN0000278917 GCCAGCATTCCAGACTTCAAA pLKO_005 801 3UTR 100% 5.625 3.938 N RAP1A n/a
12 TRCN0000029787 GCTCTGACAGTTCAGTTTGTT pLKO.1 231 CDS 100% 5.625 3.938 N RAP1A n/a
13 TRCN0000297571 GCTCTGACAGTTCAGTTTGTT pLKO_005 231 CDS 100% 5.625 3.938 N RAP1A n/a
14 TRCN0000272334 TTACAGCAATGAGGGATTTAT pLKO_005 370 CDS 100% 15.000 7.500 Y RAP1BL n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3668 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3668 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01374 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01374 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469486 TGTTACCAGGTTATACAGAGCGCG pLX_317 78.4% 99.8% 97.3% V5 (not translated due to frame shift) 542delG n/a
Download CSV