Transcript: Human NM_002891.5

Homo sapiens Ras protein specific guanine nucleotide releasing factor 1 (RASGRF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RASGRF1 (5923)
Length:
6297
CDS:
283..4104

Additional Resources:

NCBI RefSeq record:
NM_002891.5
NBCI Gene record:
RASGRF1 (5923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002891.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048044 CGCAATATTTACTGGACCAAT pLKO.1 4016 CDS 100% 4.950 6.930 N RASGRF1 n/a
2 TRCN0000048047 CCTCATTGACTGCACTTTATT pLKO.1 1839 CDS 100% 15.000 10.500 N RASGRF1 n/a
3 TRCN0000428517 TGAGGATGATATCCCATATTA pLKO_005 3935 CDS 100% 15.000 10.500 N RASGRF1 n/a
4 TRCN0000048046 CCACAGAGCATGAGGCATTAA pLKO.1 680 CDS 100% 13.200 9.240 N RASGRF1 n/a
5 TRCN0000048045 CCTGTCGTGAACTGGACAATA pLKO.1 2948 CDS 100% 13.200 9.240 N RASGRF1 n/a
6 TRCN0000048043 GCCTCCTTATATTGTGATGAT pLKO.1 2155 CDS 100% 4.950 3.465 N RASGRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002891.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11089 pDONR223 100% 90.9% 88.9% None (many diffs) n/a
2 ccsbBroad304_11089 pLX_304 0% 90.9% 88.9% V5 (many diffs) n/a
3 TRCN0000478592 TAAGTCCTAACTACTGTTCTTCAT pLX_317 9.9% 90.9% 88.9% V5 (many diffs) n/a
Download CSV