Transcript: Human NM_002893.4

Homo sapiens RB binding protein 7, chromatin remodeling factor (RBBP7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
RBBP7 (5931)
Length:
2281
CDS:
310..1587

Additional Resources:

NCBI RefSeq record:
NM_002893.4
NBCI Gene record:
RBBP7 (5931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002893.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380187 TGCTACATGAATGCTTGATTT pLKO_005 1623 3UTR 100% 13.200 18.480 N RBBP7 n/a
2 TRCN0000038888 GCGGATAAGACCGTAGCTTTA pLKO.1 1186 CDS 100% 10.800 15.120 N RBBP7 n/a
3 TRCN0000298770 GCGGATAAGACCGTAGCTTTA pLKO_005 1186 CDS 100% 10.800 15.120 N RBBP7 n/a
4 TRCN0000038884 CGTTTCTATATGACCTGGTTA pLKO.1 392 CDS 100% 4.950 6.930 N RBBP7 n/a
5 TRCN0000038887 GCACAGTTTGATGCTTCCCAT pLKO.1 577 CDS 100% 2.640 3.696 N RBBP7 n/a
6 TRCN0000298772 GCACAGTTTGATGCTTCCCAT pLKO_005 577 CDS 100% 2.640 3.696 N RBBP7 n/a
7 TRCN0000039223 CGCCTGAATGTGTGGGATTTA pLKO.1 1327 CDS 100% 13.200 10.560 N Rbbp7 n/a
8 TRCN0000302677 CGCCTGAATGTGTGGGATTTA pLKO_005 1327 CDS 100% 13.200 10.560 N Rbbp7 n/a
9 TRCN0000038885 CCTCCAGAACTCCTGTTTATT pLKO.1 1393 CDS 100% 15.000 10.500 N RBBP7 n/a
10 TRCN0000298714 CCTCCAGAACTCCTGTTTATT pLKO_005 1393 CDS 100% 15.000 10.500 N RBBP7 n/a
11 TRCN0000038886 CGTGTCATCAATGAAGAATAT pLKO.1 349 CDS 100% 13.200 9.240 N RBBP7 n/a
12 TRCN0000310320 CGTGTCATCAATGAAGAATAT pLKO_005 349 CDS 100% 13.200 9.240 N RBBP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002893.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01380 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01380 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466582 TTGCTGGAGAGACTACCACGTTGG pLX_317 33.8% 100% 100% V5 n/a
Download CSV