Transcript: Human NM_002900.3

Homo sapiens retinol binding protein 3 (RBP3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RBP3 (5949)
Length:
4290
CDS:
123..3866

Additional Resources:

NCBI RefSeq record:
NM_002900.3
NBCI Gene record:
RBP3 (5949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002900.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046888 GCTTTCCAATAACCACCTAAA pLKO.1 4080 3UTR 100% 10.800 8.640 N RBP3 n/a
2 TRCN0000046891 CCTGATGACTCTGTCAGTGAA pLKO.1 3465 CDS 100% 4.950 3.465 N RBP3 n/a
3 TRCN0000046889 GCCATCAAGAGCCATGAGATT pLKO.1 285 CDS 100% 4.950 3.465 N RBP3 n/a
4 TRCN0000046890 CCTCTTGGATAACTACTGCTT pLKO.1 224 CDS 100% 2.640 1.848 N RBP3 n/a
5 TRCN0000046892 GCAGCCCATATCCCTGAGAAT pLKO.1 3120 CDS 100% 4.950 2.970 N RBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002900.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06851 pDONR223 100% 99.9% 99.8% None 8G>N;2270T>G n/a
2 ccsbBroad304_06851 pLX_304 0% 99.9% 99.8% V5 8G>N;2270T>G n/a
3 TRCN0000469167 TAAAAAGGTTGAGCGTTAAGCGAA pLX_317 8.7% 99.9% 99.8% V5 8G>N;2270T>G n/a
Download CSV