Transcript: Human NM_002901.3

Homo sapiens reticulocalbin 1 (RCN1), mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
RCN1 (5954)
Length:
2417
CDS:
124..1119

Additional Resources:

NCBI RefSeq record:
NM_002901.3
NBCI Gene record:
RCN1 (5954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029484 CCGCAGAGTTTCATGATTCTT pLKO.1 578 CDS 100% 5.625 7.875 N RCN1 n/a
2 TRCN0000280762 CCGCAGAGTTTCATGATTCTT pLKO_005 578 CDS 100% 5.625 7.875 N RCN1 n/a
3 TRCN0000029488 CTTCAGATCATCACACCTTTA pLKO.1 596 CDS 100% 10.800 7.560 N RCN1 n/a
4 TRCN0000280834 CTTCAGATCATCACACCTTTA pLKO_005 596 CDS 100% 10.800 7.560 N RCN1 n/a
5 TRCN0000029485 GACGGGAAGTTAGACAAAGAT pLKO.1 904 CDS 100% 5.625 3.938 N RCN1 n/a
6 TRCN0000280832 GACGGGAAGTTAGACAAAGAT pLKO_005 904 CDS 100% 5.625 3.938 N RCN1 n/a
7 TRCN0000029487 AGAAGCTAACTAAAGAGGAAA pLKO.1 1016 CDS 100% 4.950 3.465 N RCN1 n/a
8 TRCN0000280761 AGAAGCTAACTAAAGAGGAAA pLKO_005 1016 CDS 100% 4.950 3.465 N RCN1 n/a
9 TRCN0000029486 CATCTTTGATAATGTCGCCAA pLKO.1 468 CDS 100% 2.160 1.512 N RCN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01384 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01384 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466278 TCGTCGCATGACCCCCTGATAATT pLX_317 28.1% 100% 100% V5 n/a
Download CSV