Transcript: Human NM_002906.3

Homo sapiens radixin (RDX), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RDX (5962)
Length:
4498
CDS:
311..2062

Additional Resources:

NCBI RefSeq record:
NM_002906.3
NBCI Gene record:
RDX (5962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002906.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062434 CGTGTATTGGAACAACACAAA pLKO.1 776 CDS 100% 4.950 6.930 N RDX n/a
2 TRCN0000415784 ATGAGCATGACGACAAGTTAA pLKO_005 993 CDS 100% 13.200 9.240 N RDX n/a
3 TRCN0000072061 CAAGTTAAAGAAGCCATCTTA pLKO.1 623 CDS 100% 5.625 3.938 N Rdx n/a
4 TRCN0000352040 CAAGTTAAAGAAGCCATCTTA pLKO_005 623 CDS 100% 5.625 3.938 N Rdx n/a
5 TRCN0000072060 CCCAATACAACTGGCAAACAA pLKO.1 374 CDS 100% 5.625 3.938 N Rdx n/a
6 TRCN0000062435 GCCAGAGATGAAACCAAGAAA pLKO.1 1922 CDS 100% 5.625 3.938 N RDX n/a
7 TRCN0000062436 GCAGACAATTAAAGCTCAGAA pLKO.1 1378 CDS 100% 4.950 3.465 N RDX n/a
8 TRCN0000062437 GCTAAATTCTTTCCTGAAGAT pLKO.1 554 CDS 100% 4.950 3.465 N RDX n/a
9 TRCN0000062433 GCCTTATGTATGGGAAACCAT pLKO.1 1154 CDS 100% 3.000 2.100 N RDX n/a
10 TRCN0000414986 GAAGCAACTTCAGGCATTAAG pLKO_005 1885 CDS 100% 13.200 7.920 N RDX n/a
11 TRCN0000377087 CCTCGTCTGAGAATCAATAAA pLKO_005 1124 CDS 100% 15.000 10.500 N Rdx n/a
12 TRCN0000072062 GTTCAGAATTAGCCCAAGCTA pLKO.1 1905 CDS 100% 3.000 2.100 N Rdx n/a
13 TRCN0000352042 GTTCAGAATTAGCCCAAGCTA pLKO_005 1905 CDS 100% 3.000 2.100 N Rdx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002906.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06855 pDONR223 100% 99.8% 99.8% None 835C>A;982A>G n/a
2 ccsbBroad304_06855 pLX_304 0% 99.8% 99.8% V5 835C>A;982A>G n/a
3 TRCN0000478656 TTCCGTTTGGCCTCCTGAACCAAT pLX_317 19.3% 99.8% 99.8% V5 835C>A;982A>G n/a
Download CSV