Transcript: Human NM_002949.4

Homo sapiens mitochondrial ribosomal protein L12 (MRPL12), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
MRPL12 (6182)
Length:
1009
CDS:
136..732

Additional Resources:

NCBI RefSeq record:
NM_002949.4
NBCI Gene record:
MRPL12 (6182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002949.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343227 TCAAAGCCAATGTCGCCAAAG pLKO_005 650 CDS 100% 6.000 8.400 N MRPL12 n/a
2 TRCN0000072657 CCGTGCGACATATGAGGAGCA pLKO.1 233 CDS 100% 0.000 0.000 N MRPL12 n/a
3 TRCN0000072656 AGCGAAAGAACGGACACATTT pLKO.1 504 CDS 100% 13.200 9.240 N MRPL12 n/a
4 TRCN0000343228 TGTCTGTGCCGTGCGACATAT pLKO_005 225 CDS 100% 13.200 9.240 N MRPL12 n/a
5 TRCN0000352758 GCGAAAGAACGGACACATTTC pLKO_005 505 CDS 100% 10.800 7.560 N MRPL12 n/a
6 TRCN0000352822 TGGAGCCGTTTGGGAGAATTG pLKO_005 831 3UTR 100% 10.800 7.560 N MRPL12 n/a
7 TRCN0000343229 CAACCTCGTCCAGGCAAAGAA pLKO_005 603 CDS 100% 5.625 3.938 N MRPL12 n/a
8 TRCN0000072653 GAAATCAAGAACTACATCCAA pLKO.1 577 CDS 100% 3.000 2.100 N MRPL12 n/a
9 TRCN0000072655 CAGCCTCACTCTCTTGGAAAT pLKO.1 351 CDS 100% 10.800 6.480 N MRPL12 n/a
10 TRCN0000072654 CAAGAACTACATCCAAGGCAT pLKO.1 582 CDS 100% 2.640 1.584 N MRPL12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002949.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01443 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01443 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472448 ATCTGACCCAGTCCAAGTCTTGCG pLX_317 85.1% 100% 100% V5 n/a
Download CSV