Transcript: Human NM_002950.4

Homo sapiens ribophorin I (RPN1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RPN1 (6184)
Length:
2284
CDS:
19..1842

Additional Resources:

NCBI RefSeq record:
NM_002950.4
NBCI Gene record:
RPN1 (6184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002950.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421891 GTGAAGCTTGCCTCTCGAAAT pLKO_005 541 CDS 100% 10.800 15.120 N RPN1 n/a
2 TRCN0000072588 CGTTTGTCCTTAACTTTCTTT pLKO.1 2007 3UTR 100% 5.625 4.500 N RPN1 n/a
3 TRCN0000421570 GCCTTTCTCACGCTATGATTA pLKO_005 795 CDS 100% 13.200 9.240 N RPN1 n/a
4 TRCN0000442610 GTGCGACAGAGTGAGCGAAAT pLKO_005 1650 CDS 100% 10.800 7.560 N RPN1 n/a
5 TRCN0000072589 GCCAAGAACATTGAAATTGAT pLKO.1 1150 CDS 100% 5.625 3.938 N RPN1 n/a
6 TRCN0000072590 CCAAGCTATGAGTACCTCTAT pLKO.1 1027 CDS 100% 4.950 3.465 N RPN1 n/a
7 TRCN0000072592 GCTCAAGAAAGACACGTACAT pLKO.1 1746 CDS 100% 4.950 3.465 N RPN1 n/a
8 TRCN0000072591 CCATTATTTCTACTCTCCCTA pLKO.1 495 CDS 100% 2.640 1.848 N RPN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002950.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06888 pDONR223 100% 99.8% 100% None 423G>A;1206C>T n/a
2 ccsbBroad304_06888 pLX_304 0% 99.8% 100% V5 423G>A;1206C>T n/a
3 TRCN0000466360 AACACTTTGTTCCTTAGACAGTAA pLX_317 21.9% 99.8% 100% V5 423G>A;1206C>T n/a
Download CSV