Transcript: Human NM_003001.3

Homo sapiens succinate dehydrogenase complex subunit C (SDHC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SDHC (6391)
Length:
2858
CDS:
31..540

Additional Resources:

NCBI RefSeq record:
NM_003001.3
NBCI Gene record:
SDHC (6391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338821 AGTACCTGGTAGACCATAATA pLKO_005 684 3UTR 100% 15.000 21.000 N SDHC n/a
2 TRCN0000028109 CCCACATTACTATCTACAGTT pLKO.1 191 CDS 100% 4.950 6.930 N SDHC n/a
3 TRCN0000028068 CCTGGGAACTTTGAGTCTTAT pLKO.1 307 CDS 100% 13.200 10.560 N SDHC n/a
4 TRCN0000338883 CCTGGGAACTTTGAGTCTTAT pLKO_005 307 CDS 100% 13.200 10.560 N SDHC n/a
5 TRCN0000272333 CCGTGGCACTGGTATTGCTTT pLKO_005 243 CDS 100% 4.950 3.960 N LOC642502 n/a
6 TRCN0000272392 ATTGCCTCCGAGCCCACTTTA pLKO_005 65 CDS 100% 13.200 9.240 N LOC642502 n/a
7 TRCN0000272391 CCTCAGCTCTGTATCAGAAAT pLKO_005 88 CDS 100% 13.200 9.240 N LOC642502 n/a
8 TRCN0000281943 TGTTACTCCCTGGGAACTTTG pLKO_005 299 CDS 100% 10.800 7.560 N LOC642502 n/a
9 TRCN0000028088 GAGCGGTTCTGGAATAAGAAT pLKO.1 145 CDS 100% 5.625 3.938 N SDHC n/a
10 TRCN0000338820 GAGCGGTTCTGGAATAAGAAT pLKO_005 145 CDS 100% 5.625 3.938 N SDHC n/a
11 TRCN0000028104 CTCATGTATCATACCTGGAAT pLKO.1 400 CDS 100% 4.950 3.465 N SDHC n/a
12 TRCN0000028038 CCCTCAGCTCTGTATCAGAAA pLKO.1 87 CDS 100% 4.950 2.970 N SDHC n/a
13 TRCN0000338819 CCCTCAGCTCTGTATCAGAAA pLKO_005 87 CDS 100% 4.950 2.970 N SDHC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01514 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01514 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474834 CCGAGTCATCCTTGGGCCGCATGT pLX_317 69.4% 100% 100% V5 n/a
Download CSV