Transcript: Human NM_003012.5

Homo sapiens secreted frizzled related protein 1 (SFRP1), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SFRP1 (6422)
Length:
4464
CDS:
315..1259

Additional Resources:

NCBI RefSeq record:
NM_003012.5
NBCI Gene record:
SFRP1 (6422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003012.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062172 CGAGATGCTTAAGTGTGACAA pLKO.1 770 CDS 100% 4.950 6.930 N SFRP1 n/a
2 TRCN0000062171 CGAGTTGAAATCTGAGGCCAT pLKO.1 887 CDS 100% 2.160 3.024 N SFRP1 n/a
3 TRCN0000062170 CCACCTTTCAGTCCGTGTTTA pLKO.1 1234 CDS 100% 13.200 9.240 N SFRP1 n/a
4 TRCN0000062168 CCGGAGAGTTATCCTGATAAA pLKO.1 3004 3UTR 100% 13.200 9.240 N SFRP1 n/a
5 TRCN0000417895 GTCAGTAGTGGACATTGTAAT pLKO_005 1359 3UTR 100% 13.200 9.240 N SFRP1 n/a
6 TRCN0000062169 CCCTGTGACAACGAGTTGAAA pLKO.1 876 CDS 100% 5.625 3.938 N SFRP1 n/a
7 TRCN0000375634 CCACAACGTGGGCTACAAGAA pLKO_005 518 CDS 100% 4.950 3.465 N Sfrp1 n/a
8 TRCN0000034483 CGAGTACGACTACGTGAGCTT pLKO.1 410 CDS 100% 2.640 1.584 N Sfrp1 n/a
9 TRCN0000034482 TCATTGAACATCTCTGTGCAA pLKO.1 907 CDS 100% 2.640 1.584 N Sfrp1 n/a
10 TRCN0000034480 GCTCAACAAGAACTGCCACAT pLKO.1 614 CDS 100% 4.050 2.835 N Sfrp1 n/a
11 TRCN0000352142 GCTCAACAAGAACTGCCACAT pLKO_005 614 CDS 100% 4.050 2.835 N Sfrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003012.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01520 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01520 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477245 ACTTTGCTCGTTGTCCGTAGAATT pLX_317 38.9% 100% 100% V5 n/a
Download CSV