Transcript: Human NM_003032.3

Homo sapiens ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (ST6GAL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
ST6GAL1 (6480)
Length:
4303
CDS:
333..1553

Additional Resources:

NCBI RefSeq record:
NM_003032.3
NBCI Gene record:
ST6GAL1 (6480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035431 CCTAAGCATGAACAAGTACAA pLKO.1 680 CDS 100% 4.950 6.930 N ST6GAL1 n/a
2 TRCN0000373581 GTACCAGAATCCGGATTATAA pLKO_005 1139 CDS 100% 0.000 0.000 N ST6GAL1 n/a
3 TRCN0000035433 GCGCTTCCTCAAAGACAGTTT pLKO.1 1055 CDS 100% 4.950 3.960 N ST6GAL1 n/a
4 TRCN0000373582 CACAAACCAATGCTCTATATT pLKO_005 1908 3UTR 100% 15.000 10.500 N ST6GAL1 n/a
5 TRCN0000373653 GACGCAGTCCTGAGGTTTAAT pLKO_005 948 CDS 100% 15.000 10.500 N ST6GAL1 n/a
6 TRCN0000035430 CCCAGAAGAGATTCAGCCAAA pLKO.1 1268 CDS 100% 4.050 2.835 N ST6GAL1 n/a
7 TRCN0000035432 CGTGTGCTACTACTACCAGAA pLKO.1 1385 CDS 100% 4.050 2.835 N ST6GAL1 n/a
8 TRCN0000035429 CGCTGCTCTATGAGAAGAATT pLKO.1 1444 CDS 100% 0.000 0.000 N ST6GAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06948 pDONR223 100% 99.9% 100% None 837C>T n/a
2 ccsbBroad304_06948 pLX_304 0% 99.9% 100% V5 837C>T n/a
3 TRCN0000476949 CCCATCCGAACCTCTTAAATTAAA pLX_317 28.5% 99.9% 100% V5 837C>T n/a
Download CSV