Transcript: Human NM_003054.6

Homo sapiens solute carrier family 18 member A2 (SLC18A2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SLC18A2 (6571)
Length:
3831
CDS:
123..1667

Additional Resources:

NCBI RefSeq record:
NM_003054.6
NBCI Gene record:
SLC18A2 (6571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003054.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421346 GCTCTTCTGGGAATGATAATT pLKO_005 1203 CDS 100% 15.000 21.000 N SLC18A2 n/a
2 TRCN0000044778 CCTATTATGATAACTCGACTA pLKO.1 361 CDS 100% 4.050 5.670 N SLC18A2 n/a
3 TRCN0000414596 GGATCACAACTGCCCTATTAA pLKO_005 1574 CDS 100% 15.000 12.000 N SLC18A2 n/a
4 TRCN0000044782 CGTGCAAGTTGGTCTGTTGTT pLKO.1 506 CDS 100% 4.950 3.960 N SLC18A2 n/a
5 TRCN0000070072 GCTCATGACAATTATTGGGAT pLKO.1 1475 CDS 100% 2.640 2.112 N Slc18a2 n/a
6 TRCN0000044781 CCGATAGGTGAAGATGAAGAA pLKO.1 1632 CDS 100% 4.950 3.465 N SLC18A2 n/a
7 TRCN0000044779 CCAACAGAATTGGCTATCCAA pLKO.1 580 CDS 100% 3.000 2.100 N SLC18A2 n/a
8 TRCN0000044780 CTTATCTCATTGGAACCAATA pLKO.1 1141 CDS 100% 10.800 6.480 N SLC18A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003054.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01550 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01550 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473069 TTGCATTGTTTTAACTCCCAGTAC pLX_317 33.4% 100% 100% V5 n/a
Download CSV