Transcript: Human NM_003060.4

Homo sapiens solute carrier family 22 member 5 (SLC22A5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC22A5 (6584)
Length:
3277
CDS:
264..1937

Additional Resources:

NCBI RefSeq record:
NM_003060.4
NBCI Gene record:
SLC22A5 (6584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003060.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425143 GAAAGGCCCACAATCCTTAAA pLKO_005 1902 CDS 100% 13.200 18.480 N SLC22A5 n/a
2 TRCN0000295729 GACCATATCAGTGGGCTATTT pLKO_005 1319 CDS 100% 13.200 18.480 N Slc22a5 n/a
3 TRCN0000038181 GCAGATCTTCTCGAAGAATTT pLKO.1 821 CDS 100% 13.200 18.480 N SLC22A5 n/a
4 TRCN0000038179 CGAGTGAGTTACAAGACCTAA pLKO.1 1207 CDS 100% 4.950 6.930 N SLC22A5 n/a
5 TRCN0000038183 CCAATGGGATTGTTGTGCCTT pLKO.1 1171 CDS 100% 2.640 3.696 N SLC22A5 n/a
6 TRCN0000424856 ACGTTAGGAGTGTGCATATTT pLKO_005 957 CDS 100% 15.000 10.500 N SLC22A5 n/a
7 TRCN0000423919 TGGCTGCTGCTGCAATATTTG pLKO_005 1434 CDS 100% 13.200 9.240 N SLC22A5 n/a
8 TRCN0000414368 CCAACTATGTGGCAGCATTTG pLKO_005 889 CDS 100% 10.800 7.560 N SLC22A5 n/a
9 TRCN0000038180 CCCACTCACAATCTCCTTGTT pLKO.1 689 CDS 100% 4.950 3.465 N SLC22A5 n/a
10 TRCN0000038182 GACCAGATGCTAAGAGTCAAA pLKO.1 1827 CDS 100% 4.950 3.465 N SLC22A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003060.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06974 pDONR223 100% 99.9% 99.8% None 341T>C n/a
2 ccsbBroad304_06974 pLX_304 0% 99.9% 99.8% V5 341T>C n/a
3 TRCN0000476123 ATTCCGCTAATGAGCCTCCCGTCA pLX_317 21.9% 99.9% 99.8% V5 341T>C n/a
Download CSV