Transcript: Human NM_003129.4

Homo sapiens squalene epoxidase (SQLE), mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
SQLE (6713)
Length:
2962
CDS:
900..2624

Additional Resources:

NCBI RefSeq record:
NM_003129.4
NBCI Gene record:
SQLE (6713)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003129.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303669 ATAGTACCATACCACTTATAA pLKO_005 2705 3UTR 100% 15.000 21.000 N SQLE n/a
2 TRCN0000076684 CCAGTTCTCATCTACCAGATT pLKO.1 1890 CDS 100% 4.950 3.960 N Sqle n/a
3 TRCN0000327505 CCAGTTCTCATCTACCAGATT pLKO_005 1890 CDS 100% 4.950 3.960 N Sqle n/a
4 TRCN0000046153 GCTCAGGCTCTTTATGAATTA pLKO.1 2307 CDS 100% 13.200 9.240 N SQLE n/a
5 TRCN0000299629 GCTCAGGCTCTTTATGAATTA pLKO_005 2307 CDS 100% 13.200 9.240 N SQLE n/a
6 TRCN0000303736 TTCGCCCTCTTCTCGGATATT pLKO_005 1086 CDS 100% 13.200 9.240 N SQLE n/a
7 TRCN0000046157 GCACCACAGTTTAAAGCAAAT pLKO.1 1839 CDS 100% 10.800 7.560 N SQLE n/a
8 TRCN0000299564 GCACCACAGTTTAAAGCAAAT pLKO_005 1839 CDS 100% 10.800 7.560 N SQLE n/a
9 TRCN0000046155 GCAGAGCCCAATGCAAAGTTT pLKO.1 1614 CDS 100% 5.625 3.938 N SQLE n/a
10 TRCN0000299630 GCAGAGCCCAATGCAAAGTTT pLKO_005 1614 CDS 100% 5.625 3.938 N SQLE n/a
11 TRCN0000046154 CCTGCCTTTCATTGGCTTCTT pLKO.1 1115 CDS 100% 4.950 3.465 N SQLE n/a
12 TRCN0000046156 GCTTTCTGTATTGTCTCCTAA pLKO.1 2423 CDS 100% 4.950 3.465 N SQLE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003129.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01589 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01589 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475588 ATCGGATTTGTCAAAACTGAAAGC pLX_317 17.3% 100% 100% V5 n/a
Download CSV