Transcript: Human NM_003186.5

Homo sapiens transgelin (TAGLN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TAGLN (6876)
Length:
3786
CDS:
76..681

Additional Resources:

NCBI RefSeq record:
NM_003186.5
NBCI Gene record:
TAGLN (6876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003186.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308288 CCTCGGCAGATCATCAGTTAG pLKO_005 661 CDS 100% 10.800 7.560 N TAGLN n/a
2 TRCN0000072751 CAGACTGTTGACCTCTTTGAA pLKO.1 412 CDS 100% 5.625 3.938 N TAGLN n/a
3 TRCN0000307738 CAGACTGTTGACCTCTTTGAA pLKO_005 412 CDS 100% 5.625 3.938 N TAGLN n/a
4 TRCN0000072750 GCATGTCATTGGCCTTCAGAT pLKO.1 591 CDS 100% 4.950 3.465 N TAGLN n/a
5 TRCN0000307739 GCATGTCATTGGCCTTCAGAT pLKO_005 591 CDS 100% 4.950 3.465 N TAGLN n/a
6 TRCN0000072748 CCAACTTCTTACCCGAAAGCA pLKO.1 861 3UTR 100% 3.000 2.100 N TAGLN n/a
7 TRCN0000291563 CCAACTTCTTACCCGAAAGCA pLKO_005 861 3UTR 100% 3.000 2.100 N TAGLN n/a
8 TRCN0000072752 GAGTGGATCATAGTGCAGTGT pLKO.1 169 CDS 100% 2.640 1.848 N TAGLN n/a
9 TRCN0000072749 GCAGGAGCATAAGAGGGAATT pLKO.1 543 CDS 100% 0.000 0.000 N TAGLN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003186.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01638 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01638 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468940 GCAGCTTGCAGGTTATGGCCTGCC pLX_317 64.5% 100% 100% V5 n/a
4 ccsbBroadEn_15602 pDONR223 0% 14.8% 7.9% None (many diffs) n/a
5 ccsbBroad304_15602 pLX_304 0% 14.8% 7.9% V5 (many diffs) n/a
6 TRCN0000470735 TAGACTTCCGGACATATGTATAAT pLX_317 100% 14.8% 7.9% V5 (many diffs) n/a
Download CSV