Transcript: Human NM_003213.4

Homo sapiens TEA domain transcription factor 4 (TEAD4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
TEAD4 (7004)
Length:
1710
CDS:
208..1512

Additional Resources:

NCBI RefSeq record:
NM_003213.4
NBCI Gene record:
TEAD4 (7004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003213.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015874 CCCGGATATTGAGCAGAGTTT pLKO.1 339 CDS 100% 4.950 6.930 N TEAD4 n/a
2 TRCN0000274223 CGAGATCCAGGCCAAGCTAAA pLKO_005 540 CDS 100% 10.800 8.640 N TEAD4 n/a
3 TRCN0000274171 TGGACAAGCCCATCGACAATG pLKO_005 299 CDS 100% 10.800 7.560 N TEAD4 n/a
4 TRCN0000015876 CCTTTCTCTCAGCAAACCTAT pLKO.1 742 CDS 100% 4.950 3.465 N TEAD4 n/a
5 TRCN0000285158 CCTTTCTCTCAGCAAACCTAT pLKO_005 742 CDS 100% 4.950 3.465 N TEAD4 n/a
6 TRCN0000015877 GCTGTGCATTGCCTATGTCTT pLKO.1 1431 CDS 100% 4.950 3.465 N TEAD4 n/a
7 TRCN0000285155 GCTGTGCATTGCCTATGTCTT pLKO_005 1431 CDS 100% 4.950 3.465 N TEAD4 n/a
8 TRCN0000015875 GAGACAGAGTATGCTCGCTAT pLKO.1 1243 CDS 100% 4.050 2.835 N TEAD4 n/a
9 TRCN0000285156 GAGACAGAGTATGCTCGCTAT pLKO_005 1243 CDS 100% 4.050 2.835 N TEAD4 n/a
10 TRCN0000015873 GAAGAGACGTGTGTGCAGGAA pLKO.1 1537 3UTR 100% 2.640 1.848 N TEAD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003213.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07045 pDONR223 100% 83.1% 83.1% None 1_219del n/a
2 ccsbBroad304_07045 pLX_304 0% 83.1% 83.1% V5 1_219del n/a
3 TRCN0000467876 AGTCAGAACTTTTGAAATTTTATT pLX_317 29.2% 83.1% 83.1% V5 1_219del n/a
Download CSV