Transcript: Human NM_003216.4

Homo sapiens TEF transcription factor, PAR bZIP family member (TEF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TEF (7008)
Length:
4381
CDS:
104..1015

Additional Resources:

NCBI RefSeq record:
NM_003216.4
NBCI Gene record:
TEF (7008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003216.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016024 CCATCCCATATGATGGCGAAT pLKO.1 360 CDS 100% 0.000 0.000 N TEF n/a
2 TRCN0000229679 ATGACTTCCAGGTGGATATTG pLKO_005 4036 3UTR 100% 13.200 9.240 N TEF n/a
3 TRCN0000218853 GTCCAAGTATGAGACCAAATA pLKO_005 982 CDS 100% 13.200 9.240 N TEF n/a
4 TRCN0000257399 ACCCTCGGAAGCACAAGTTTG pLKO_005 708 CDS 100% 10.800 7.560 N TEF n/a
5 TRCN0000016026 GTACTGGACAAGACGCAAGAA pLKO.1 808 CDS 100% 4.950 3.465 N TEF n/a
6 TRCN0000229678 GTACTGGACAAGACGCAAGAA pLKO_005 808 CDS 100% 4.950 3.465 N TEF n/a
7 TRCN0000016023 CCCTCTTATCTAGGAGGCTTT pLKO.1 1907 3UTR 100% 4.050 2.835 N TEF n/a
8 TRCN0000016025 CGTGTCCAAGTATGAGACCAA pLKO.1 979 CDS 100% 2.640 1.848 N TEF n/a
9 TRCN0000016027 GCCATCTTTCAGCCCTCTGAA pLKO.1 542 CDS 100% 0.495 0.347 N TEF n/a
10 TRCN0000218112 GAAGTGGATGTGAACTTCAAT pLKO_005 635 CDS 100% 0.563 0.338 N TEF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003216.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07046 pDONR223 100% 98.2% 98.3% None 462C>T;895_909del n/a
2 ccsbBroad304_07046 pLX_304 0% 98.2% 98.3% V5 462C>T;895_909del n/a
3 TRCN0000472817 CCTAAATAGATCCTATTGTTCCAC pLX_317 37.8% 98.2% 98.3% V5 462C>T;895_909del n/a
Download CSV