Transcript: Human NM_003238.6

Homo sapiens transforming growth factor beta 2 (TGFB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TGFB2 (7042)
Length:
5868
CDS:
1367..2611

Additional Resources:

NCBI RefSeq record:
NM_003238.6
NBCI Gene record:
TGFB2 (7042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003238.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373681 ACGAACCCAAAGGGTACAATG pLKO_005 2373 CDS 100% 10.800 15.120 N TGFB2 n/a
2 TRCN0000033425 CGGATTGAGCTATATCAGATT pLKO.1 1859 CDS 100% 4.950 6.930 N TGFB2 n/a
3 TRCN0000033424 GCGGCCTATTGCTTTAGAAAT pLKO.1 2282 CDS 100% 13.200 10.560 N TGFB2 n/a
4 TRCN0000373682 GCTGGAGCATGCCCGTATTTA pLKO_005 2405 CDS 100% 15.000 10.500 N TGFB2 n/a
5 TRCN0000373680 TTGCTGCCTACGTCCACTTTA pLKO_005 2314 CDS 100% 13.200 9.240 N TGFB2 n/a
6 TRCN0000033427 CCAAGATTGAACAGCTTTCTA pLKO.1 2559 CDS 100% 5.625 3.938 N TGFB2 n/a
7 TRCN0000033426 GCTTTAGAAATGTGCAGGATA pLKO.1 2292 CDS 100% 4.950 3.465 N TGFB2 n/a
8 TRCN0000033428 CACACTCGATATGGACCAGTT pLKO.1 1441 CDS 100% 4.050 2.835 N TGFB2 n/a
9 TRCN0000313040 TACTACGCCAAGGAGGTTTAT pLKO_005 1658 CDS 100% 13.200 9.240 N Tgfb2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 722 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003238.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07057 pDONR223 100% 99.9% 99.7% None 1241G>T n/a
2 ccsbBroad304_07057 pLX_304 0% 99.9% 99.7% V5 1241G>T n/a
3 TRCN0000476634 CGTCATACCTCACTCTAATCTTTC pLX_317 30.9% 99.9% 99.7% V5 1241G>T n/a
Download CSV