Transcript: Human NM_003260.5

Homo sapiens TLE family member 2, transcriptional corepressor (TLE2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TLE2 (7089)
Length:
2812
CDS:
377..2608

Additional Resources:

NCBI RefSeq record:
NM_003260.5
NBCI Gene record:
TLE2 (7089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003260.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019631 GCTCAACATTGAAATGCATAA pLKO.1 583 CDS 100% 10.800 7.560 N TLE2 n/a
2 TRCN0000278297 GCTCAACATTGAAATGCATAA pLKO_005 583 CDS 100% 10.800 7.560 N TLE2 n/a
3 TRCN0000019633 CTACATTCGTTCCTGCAAGTT pLKO.1 1888 CDS 100% 4.950 3.465 N TLE2 n/a
4 TRCN0000297429 CTACATTCGTTCCTGCAAGTT pLKO_005 1888 CDS 100% 4.950 3.465 N TLE2 n/a
5 TRCN0000019632 GAGTTGTGACATCTCCAGAAA pLKO.1 2524 CDS 100% 4.950 3.465 N TLE2 n/a
6 TRCN0000278367 GAGTTGTGACATCTCCAGAAA pLKO_005 2524 CDS 100% 4.950 3.465 N TLE2 n/a
7 TRCN0000019630 GCGACGAAGACAAGAGTGATT pLKO.1 1059 CDS 100% 4.950 3.465 N TLE2 n/a
8 TRCN0000278300 GCGACGAAGACAAGAGTGATT pLKO_005 1059 CDS 100% 4.950 3.465 N TLE2 n/a
9 TRCN0000098266 CCTCAAGCTAGAATGTGAGAA pLKO.1 499 CDS 100% 4.950 2.970 N Tle2 n/a
10 TRCN0000019629 GCTGCATTGATATTTCCGATT pLKO.1 2154 CDS 100% 4.050 2.430 N TLE2 n/a
11 TRCN0000278299 GCTGCATTGATATTTCCGATT pLKO_005 2154 CDS 100% 4.050 2.430 N TLE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003260.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01677 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01677 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474959 AATGTACAAAGTATTTTTGATATG pLX_317 12.1% 100% 100% V5 n/a
Download CSV