Construct: ORF TRCN0000474959
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008794.1_s317c1
- Derived from:
- ccsbBroadEn_01677
- DNA Barcode:
- AATGTACAAAGTATTTTTGATATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TLE2 (7089)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474959
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7089 | TLE2 | TLE family member 2, transc... | NM_003260.5 | 100% | 100% | |
| 2 | human | 7089 | TLE2 | TLE family member 2, transc... | NM_001300846.2 | 99.8% | 99.8% | 369_371delGCA |
| 3 | human | 7089 | TLE2 | TLE family member 2, transc... | XM_011528230.1 | 98.2% | 98.2% | 369_371delGCA;1139_1140ins36 |
| 4 | human | 7089 | TLE2 | TLE family member 2, transc... | XM_006722864.2 | 93% | 91.8% | 369_371delGCA;2049_2050ins77;2079_2080ins76 |
| 5 | human | 7089 | TLE2 | TLE family member 2, transc... | NM_001144761.1 | 90.7% | 89.2% | (many diffs) |
| 6 | human | 7089 | TLE2 | TLE family member 2, transc... | NM_001144762.1 | 83.5% | 83.5% | 0_1ins165;202_203ins201 |
| 7 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243436.2 | 84.4% | 91.4% | (many diffs) |
| 8 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_006513589.3 | 84.3% | 91.2% | (many diffs) |
| 9 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243437.1 | 84.2% | 91.1% | (many diffs) |
| 10 | mouse | 21886 | Tle2 | transducin-like enhancer of... | NM_001252401.1 | 83.4% | 90% | (many diffs) |
| 11 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_006513585.2 | 81.8% | 88.5% | (many diffs) |
| 12 | mouse | 21886 | Tle2 | transducin-like enhancer of... | NM_019725.2 | 81.7% | 88.4% | (many diffs) |
| 13 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_006513584.2 | 81.7% | 88.4% | (many diffs) |
| 14 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_017313922.1 | 80.4% | 87.1% | (many diffs) |
| 15 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_006513586.2 | 76.3% | 80.8% | (many diffs) |
| 16 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_017313920.1 | 75.3% | 77.9% | (many diffs) |
| 17 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_017313919.1 | 75.2% | 77.8% | (many diffs) |
| 18 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243432.2 | 75.1% | 77.7% | (many diffs) |
| 19 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243434.2 | 75.1% | 77.7% | (many diffs) |
| 20 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_017313921.1 | 74% | 76.5% | (many diffs) |
| 21 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243433.2 | 73.9% | 76.4% | (many diffs) |
| 22 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243425.2 | 73.2% | 75.7% | (many diffs) |
| 23 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243426.2 | 73.2% | 75.7% | (many diffs) |
| 24 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243435.2 | 73.1% | 75.5% | (many diffs) |
| 25 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243424.2 | 73.1% | 75.6% | (many diffs) |
| 26 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243429.2 | 73.1% | 75.6% | (many diffs) |
| 27 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243427.2 | 72.1% | 74.4% | (many diffs) |
| 28 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243428.2 | 71.9% | 74.4% | (many diffs) |
| 29 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243431.2 | 71.2% | 73.6% | (many diffs) |
| 30 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_011243430.2 | 71.2% | 73.5% | (many diffs) |
| 31 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_017313923.1 | 70.3% | 74.4% | (many diffs) |
| 32 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_017313924.1 | 55.3% | 57.6% | (many diffs) |
| 33 | mouse | 21886 | Tle2 | transducin-like enhancer of... | XM_006513588.3 | 55.2% | 57.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2295
- ORF length:
- 2229
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta cccccaggga aggcacccga ccccgctcca gtccggccag cccttcaagt 121 tctcgatctt ggagatctgc gaccgcatca aagaagaatt ccagtttctt caggctcaat 181 accacagcct caagctagaa tgtgagaagc tggccagcga gaagacggaa atgcagcgac 241 attatgtcat gtattatgag atgtcgtacg ggctcaacat tgaaatgcat aagcaggcgg 301 agattgtgaa gcgtctgagc ggtatctgcg ctcagattat ccccttcctg acccaggagc 361 atcagcagca ggtgctccag gccgtagaac gcgccaagca ggtcaccgtg ggggagctga 421 acagcctcat cgggcagcag ctccagccgc tgtcccacca cgcaccccct gtgcccctca 481 ccccccgccc agccgggctg gtgggcggca gtgctacggg gctgcttgct ctgtctggag 541 ccctggctgc ccaggctcag ctggcggcgg ctgtcaagga ggaccgtgcg ggcgtggagg 601 ccgaggggtc cagagtggag agagccccga gcaggagtgc atctccctcg ccccctgaga 661 gtctcgtgga ggaggagcga ccgagtggcc ctggtggtgg cgggaagcag agagcagatg 721 agaaggagcc atcaggacct tatgaaagcg acgaagacaa gagtgattac aatctggtgg 781 tggacgagga ccaaccctca gagcccccca gcccggctac caccccctgc ggaaaggtac 841 ccatctgcat tcctgcccgt cgggacctgg tggacagtcc agcctccttg gcctctagcc 901 ttggctcacc gctgcctaga gccaaggagc tcatcctgaa tgaccttccc gccagcactc 961 ctgcctccaa atcctgtgac tcctccccgc cccaggacgc ttccaccccc gggcccagct 1021 cggccagtca cctctgccag cttgctgcca agccagcacc ttccacggac agcgtcgccc 1081 tgaggagccc cctgactctg tccagtccct tcaccacgtc cttcagcctg ggctcccaca 1141 gcactctcaa cggagacctc tccgtgccca gctcctacgt cagcctccac ctgtcccccc 1201 aggtcagcag ctctgtggtg tacggacgct cccccgtgat ggcatttgag tctcatcccc 1261 atctccgagg gtcatccgtc tcttcctccc tacccagcat ccctggggga aagccggcct 1321 actccttcca cgtgtctgcg gacgggcaga tgcagccggt tcccttcccc tcggatgcac 1381 tggtaggcgc gggcatcccg cggcacgccc ggcagctgca cacgctggcc catggcgagg 1441 tggtctgcgc ggtcaccatc agcggctcca cacagcatgt gtacacgggc ggcaagggct 1501 gtgtgaaggt gtgggacgtg ggccagcctg gggccaagac gcccgtggcc cagctcgact 1561 gcctgaaccg agacaactac attcgttcct gcaagttgct gccggatggc cggagtctga 1621 tcgtgggcgg tgaggccagc accttgtcca tttgggacct ggcggcgccc accccccgta 1681 tcaaggccga gctgacttcc tcagccccag cctgctacgc cctggccgtc agccccgacg 1741 ccaaggtttg cttctcctgc tgcagcgatg gcaacattgt ggtctgggac ctgcagaatc 1801 agactatggt caggcagttc cagggccaca cggacggcgc cagctgcatt gatatttccg 1861 attacggcac tcggctctgg acagggggcc tggacaacac ggtgcgctgc tgggacctgc 1921 gggagggccg ccagctgcag cagcatgact tcagctccca gattttctcc ctgggccact 1981 gccctaacca ggactggctg gcggtcggaa tggagagtag caacgtggag atCCTGCACG 2041 TCCGCAAGCC GGAGAAATAC CAGCTGCACC TCCACGAGAG CTGCGTGCTG TCCCTGAAGT 2101 TTGCCTCCTG CGGACGGTGG TTTGTGAGCA CCGGGAAGGA CAACCTGCTC AACGCCTGGA 2161 GGACGCCGTA CGGGGCCAGC ATTTTCCAGT CCAAGGAGTC GTCCTCAGTC CTGAGTTGTG 2221 ACATCTCCAG AAATAACAAA TACATCGTGA CAGGCTCGGG GGACAAGAAG GCCACCGTGT 2281 ATGAGGTGGT CTACTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2341 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2401 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AATGTACAAA GTATTTTTGA 2461 TATGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt