Transcript: Human NM_003278.3

Homo sapiens C-type lectin domain family 3 member B (CLEC3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CLEC3B (7123)
Length:
816
CDS:
61..669

Additional Resources:

NCBI RefSeq record:
NM_003278.3
NBCI Gene record:
CLEC3B (7123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371799 CAACGGCAAGTGGTTCGACAA pLKO_005 600 CDS 100% 4.050 5.670 N CLEC3B n/a
2 TRCN0000062477 CAAGGTGCACATGAAATGCTT pLKO.1 285 CDS 100% 3.000 2.400 N CLEC3B n/a
3 TRCN0000062475 AGATGTTGTGAACACAAAGAT pLKO.1 168 CDS 100% 5.625 3.938 N CLEC3B n/a
4 TRCN0000062474 CAGAAGCCCAAGAAGATTGTA pLKO.1 136 CDS 100% 5.625 3.938 N CLEC3B n/a
5 TRCN0000371855 AGATGTTTGAGGAGCTCAAGA pLKO_005 185 CDS 100% 4.950 3.465 N CLEC3B n/a
6 TRCN0000371800 GAAGATTGTAAATGCCAAGAA pLKO_005 147 CDS 100% 4.950 3.465 N CLEC3B n/a
7 TRCN0000062476 GCCTACAAGAACTGGGAGACT pLKO.1 517 CDS 100% 2.640 1.584 N CLEC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07084 pDONR223 100% 99.6% 99% None 10T>G;316G>A n/a
2 ccsbBroad304_07084 pLX_304 0% 99.6% 99% V5 10T>G;316G>A n/a
3 TRCN0000468526 GAAATATTTGGATCGAAACTACGA pLX_317 70.1% 99.6% 99% V5 10T>G;316G>A n/a
Download CSV