Transcript: Human NM_003341.5

Homo sapiens ubiquitin conjugating enzyme E2 E1 (UBE2E1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
UBE2E1 (7324)
Length:
1783
CDS:
168..749

Additional Resources:

NCBI RefSeq record:
NM_003341.5
NBCI Gene record:
UBE2E1 (7324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003341.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040810 CCCAAGAAGAAGGAGAGTAAA pLKO.1 252 CDS 100% 13.200 9.240 N Ube2e1 n/a
2 TRCN0000004014 GTTGGTAAAGAGTAGGGTATT pLKO.1 833 3UTR 100% 10.800 7.560 N UBE2E1 n/a
3 TRCN0000279816 GTTGGTAAAGAGTAGGGTATT pLKO_005 833 3UTR 100% 10.800 7.560 N UBE2E1 n/a
4 TRCN0000004017 GCAAACCGAGAAAGAAACAAA pLKO.1 227 CDS 100% 5.625 3.938 N UBE2E1 n/a
5 TRCN0000279752 GCAAACCGAGAAAGAAACAAA pLKO_005 227 CDS 100% 5.625 3.938 N UBE2E1 n/a
6 TRCN0000004018 GTCCAGCACTAACCATTTCTA pLKO.1 586 CDS 100% 5.625 3.938 N UBE2E1 n/a
7 TRCN0000279818 GTCCAGCACTAACCATTTCTA pLKO_005 586 CDS 100% 5.625 3.938 N UBE2E1 n/a
8 TRCN0000004015 CCGTGTATGAGGGTGGTGTAT pLKO.1 433 CDS 100% 4.950 3.465 N UBE2E1 n/a
9 TRCN0000004016 CCTCCTTTCTATCTGCTCACT pLKO.1 611 CDS 100% 2.640 1.848 N UBE2E1 n/a
10 TRCN0000279827 CCTCCTTTCTATCTGCTCACT pLKO_005 611 CDS 100% 2.640 1.848 N UBE2E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003341.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.