Transcript: Human NM_003342.4

Homo sapiens ubiquitin conjugating enzyme E2 G1 (UBE2G1), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
UBE2G1 (7326)
Length:
4208
CDS:
359..871

Additional Resources:

NCBI RefSeq record:
NM_003342.4
NBCI Gene record:
UBE2G1 (7326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003342.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007202 CGATGGGAAGTCCTTATTATT pLKO.1 467 CDS 100% 15.000 12.000 N UBE2G1 n/a
2 TRCN0000349554 CGATGGGAAGTCCTTATTATT pLKO_005 467 CDS 100% 15.000 12.000 N UBE2G1 n/a
3 TRCN0000007204 CCTCCAGATACACTTTATGAA pLKO.1 491 CDS 100% 5.625 4.500 N UBE2G1 n/a
4 TRCN0000318544 CCTCCAGATACACTTTATGAA pLKO_005 491 CDS 100% 5.625 4.500 N UBE2G1 n/a
5 TRCN0000007203 GCAGGTTTAATAGATGACAAT pLKO.1 437 CDS 100% 4.950 3.465 N UBE2G1 n/a
6 TRCN0000007201 GCTAATGTTGATGCTGCGAAA pLKO.1 767 CDS 100% 4.050 2.835 N UBE2G1 n/a
7 TRCN0000349555 GCTAATGTTGATGCTGCGAAA pLKO_005 767 CDS 100% 4.050 2.835 N UBE2G1 n/a
8 TRCN0000007200 GCCTGGTATTAAGGTTGGATA pLKO.1 1733 3UTR 100% 4.950 2.475 Y UBE2G1 n/a
9 TRCN0000318545 GCCTGGTATTAAGGTTGGATA pLKO_005 1733 3UTR 100% 4.950 2.475 Y UBE2G1 n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3008 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003342.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01738 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01738 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479687 GTCCTCAAGCTGACAACTGCAAGA pLX_317 83.7% 100% 100% V5 n/a
Download CSV