Transcript: Human NM_003420.4

Homo sapiens zinc finger protein 35 (ZNF35), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF35 (7584)
Length:
2658
CDS:
231..1814

Additional Resources:

NCBI RefSeq record:
NM_003420.4
NBCI Gene record:
ZNF35 (7584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014980 GTCAGAACATATCCTGGGATA pLKO.1 424 CDS 100% 4.050 5.670 N ZNF35 n/a
2 TRCN0000271241 ACCCTTGGCAGCTACTCATTA pLKO_005 489 CDS 100% 13.200 10.560 N ZNF35 n/a
3 TRCN0000014981 CCTTAATTCTGGCGCTGTTAA pLKO.1 842 CDS 100% 13.200 10.560 N ZNF35 n/a
4 TRCN0000271304 GACCTCCAGCATTGGTCATAA pLKO_005 1832 3UTR 100% 13.200 10.560 N ZNF35 n/a
5 TRCN0000271242 TAGAACCCATCTTGTTGAATA pLKO_005 1793 CDS 100% 13.200 10.560 N ZNF35 n/a
6 TRCN0000271302 AGTCAGCTCTCTTGCCTTATT pLKO_005 1512 CDS 100% 13.200 9.240 N ZNF35 n/a
7 TRCN0000271301 GGCACCAGAAAGTCCACATTA pLKO_005 1198 CDS 100% 13.200 9.240 N ZNF35 n/a
8 TRCN0000014982 TGTAGCTCATACCTACTTATT pLKO.1 1599 CDS 100% 13.200 9.240 N ZNF35 n/a
9 TRCN0000014979 CCCTCATCATATCAGAAAGAA pLKO.1 634 CDS 100% 5.625 3.938 N ZNF35 n/a
10 TRCN0000014978 CCAGCTATATTCATTTGCCAA pLKO.1 2507 3UTR 100% 2.640 1.848 N ZNF35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003420.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01798 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01798 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477137 TACATTTTATAAATGTTAGCGCCC pLX_317 18.3% 100% 100% V5 n/a
Download CSV