Transcript: Human NM_003500.4

Homo sapiens acyl-CoA oxidase 2 (ACOX2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ACOX2 (8309)
Length:
2297
CDS:
164..2209

Additional Resources:

NCBI RefSeq record:
NM_003500.4
NBCI Gene record:
ACOX2 (8309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003500.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046214 GCATTCCACATCCGGTTGATA pLKO.1 413 CDS 100% 5.625 3.938 N ACOX2 n/a
2 TRCN0000046216 GCTCAGAAGTCACCAACCAAT pLKO.1 2120 CDS 100% 4.950 3.465 N ACOX2 n/a
3 TRCN0000046213 GCCATCAGTTATGCCTTCCAT pLKO.1 1217 CDS 100% 3.000 2.100 N ACOX2 n/a
4 TRCN0000046215 CGAGAGGTATATGCAGTCCTT pLKO.1 235 CDS 100% 2.640 1.848 N ACOX2 n/a
5 TRCN0000046217 CCATGCCATACATGGAATCTT pLKO.1 1897 CDS 100% 0.563 0.394 N ACOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003500.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01887 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01887 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466934 AATTGTACTGGTACGATGCTTTCG pLX_317 21.1% 100% 100% V5 n/a
Download CSV