Transcript: Human NM_003768.5

Homo sapiens proliferation and apoptosis adaptor protein 15 (PEA15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PEA15 (8682)
Length:
2420
CDS:
142..534

Additional Resources:

NCBI RefSeq record:
NM_003768.5
NBCI Gene record:
PEA15 (8682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003768.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105787 CAAAGACAACCTCTCCTACAT pLKO.1 309 CDS 100% 4.950 6.930 N Pea15a n/a
2 TRCN0000288175 CAAAGACAACCTCTCCTACAT pLKO_005 309 CDS 100% 4.950 6.930 N Pea15a n/a
3 TRCN0000059391 CCAAGAAGTACAAAGACATTA pLKO.1 455 CDS 100% 13.200 9.240 N PEA15 n/a
4 TRCN0000286681 CCAAGAAGTACAAAGACATTA pLKO_005 455 CDS 100% 13.200 9.240 N PEA15 n/a
5 TRCN0000294023 CTGAGGAAGAGATCATCAAAT pLKO_005 488 CDS 100% 13.200 9.240 N PEA15 n/a
6 TRCN0000298690 TACTGGCAGTGCCTGGTTTAG pLKO_005 261 CDS 100% 10.800 7.560 N PEA15 n/a
7 TRCN0000059388 GCAGAATCAAATTGCTACATA pLKO.1 1775 3UTR 100% 5.625 3.938 N PEA15 n/a
8 TRCN0000059389 CCTCTCCTACATTGAGCACAT pLKO.1 318 CDS 100% 4.050 2.835 N PEA15 n/a
9 TRCN0000286682 CCTCTCCTACATTGAGCACAT pLKO_005 318 CDS 100% 4.050 2.835 N PEA15 n/a
10 TRCN0000059390 CTGACCAACAACATCACCCTT pLKO.1 172 CDS 100% 2.640 1.848 N PEA15 n/a
11 TRCN0000105789 CCTGACCAACAACATCACCCT pLKO.1 171 CDS 100% 0.660 0.462 N Pea15a n/a
12 TRCN0000288240 CCTGACCAACAACATCACCCT pLKO_005 171 CDS 100% 0.660 0.462 N Pea15a n/a
13 TRCN0000059392 AGCCACAACAAGCTGGACAAA pLKO.1 292 CDS 100% 4.950 2.970 N PEA15 n/a
14 TRCN0000311654 AGCCACAACAAGCTGGACAAA pLKO_005 292 CDS 100% 4.950 2.970 N PEA15 n/a
15 TRCN0000105788 CTATGGTGGTTGACTACAGAA pLKO.1 371 CDS 100% 4.950 2.970 N Pea15a n/a
16 TRCN0000307569 ACACCAAGCTAACCCGTATTC pLKO_005 428 CDS 100% 10.800 15.120 N Pea15a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003768.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01989 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01989 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465411 GTCTAATCTTTCATAAAAATGCCG pLX_317 93.1% 100% 100% V5 n/a
4 ccsbBroadEn_07284 pDONR223 100% 99.7% 100% None 264G>A n/a
Download CSV